Хондропротектор пиаскледин: Пиаскледин 300 инструкция по применению: показания, противопоказания, побочное действие – описание Piascledine 300 Капсулы (6911)

Содержание

Пиаскледин-300 — болезнь-модифицирующий препарат для лечения остеоартроза

Статья опубликована на с. 13-17

 

Остеоартроз (ОА) — очень распространенное заболевание суставов, которым страдают около 80 % населения в возрасте 50–60 лет, приводящее к ограничению физической активности и, как следствие, к снижению общего качества жизни. По данным Центра контроля заболеваемости в США, ОА представляется более существенным фактором ограничения активности пожилых людей, чем артериальная гипертензия, ишемическая болезнь сердца (ИБС), слепота или сахарный диабет. Это, несомненно, диктует необходимость поиска эффективных препаратов для лечения пациентов с ОА. 

22–23 октября 2015 года состоялась научно-практическая конференция Ассоциации ревматологов Украины «Стандартизированные подходы к диагностике и лечению ревматических болезней». В рамках конференции был проведен круглый стол «Новые возможности в лечении остеоартроза».

С докладом «Современные возможности оценки болезнь-модифицирующего потенциала препаратов для лечения остеоартроза» выступил профессор О.
Б. Яременко.

Как известно, на сегодняшний день в различных рекомендациях по терапии ОА пункт о структурно-модифицирующем направлении остается вариабельным, так как среди препаратов, замедляющих процесс дегенерации хряща и имеющих доказанную эффективность, нет однозначно принятых всеми специалистами в этой области. Одна из причин сложившейся ситуации — отсутствие унифицированных методических подходов к оценке препаратов такого действия. А между тем именно замедление процесса прогрессирования остеоартроза является одной из задач лечения этого заболевания. Согласно рекомендациям Ассоциации ревматологов Украины 2004 года критериями качества лечения остеоартроза являются отсутствие или существенное снижение проявлений суставного синдрома, отсутствие рецидивов синовита, улучшение качества жизни пациента; одним из желаемых результатов является также замедление рентгенологического прогрессирования процесса, деструктивных изменений суставного хряща по данным ультразвукового исследования суставов и МРТ.

 

Рентгенологическое исследование при ОА проводится с использованием ионизирующего излучения и в клинической практике применяется для подтверждения диагноза и установления стадии ОА. В клинических исследованиях проводится полуколичественная оценка по шкале Kellgren — Lawrence или шкале OARSI и количественная оценка сужения суставной щели. Последнее исследование используется наиболее часто и имеет ряд преимуществ. Это воспроизводимый, недорогой, общедоступный, общепризнанный метод, позволяющий визуализировать остеофиты, склероз и наличие кист. Однако этот метод имеет и существенные недостатки. Кроме вредного ионизирующего излучения, он не позволяет визуализировать хрящевую ткань. Проблема также заключается в том, что методика проведения рентгенологического исследования долгие годы не была унифицирована, позиция больного при проведении исследования в динамике не была строго установленной, могла изменяться, что приводило к несопоставимости результатов разных исследований и трудностям оценки динамики сужения суставной щели.

Несколько лет назад по рекомендации ЕМА и FDA методика проведения рентгенографии была стандартизирована с целью получения адекватного изображения и измерения ширины суставной щели (ШСЩ). Согласно этой методике рентгенограмма переднезадней проекции коленного сустава производится в зафиксированном положении благодаря фиксирующему устройству. Угол направления луча составляет 10°. Установлено, что ШСЩ необходимо измерять на расстоянии 15 мм от края суставной щели на протяжении 3 см с последующим расчетом средней ШСЩ. Однако, несмотря на унификацию этой методики, важным ее недостатком является невозможность визуализировать мягкие ткани, а состояние и толщина суставного хряща оцениваются опосредованно, по ШСЩ. Этот недостаток не позволяют считать метод рентгенографии эталонным в оценке структурно-модифицирующего действия препаратов. Высокая точность ультразвуковой визуализации изменений бедренного хряща у больных ОА доказана при сравнении данных УЗИ и артроскопии. Результаты изучения корреляции величин толщины суставного хряща, полученных по данным УЗИ и по данным аутопсий, доказали возможность использования данного метода у больных ОА коленного сустава, как с минимальными изменениями, так и при значительном поражении сустава.
Однако методика УЗИ при данной патологии также не стандартизирована и потому не рекомендована для проведения рандомизированных исследований эффективности структурно-модифицирующей терапии ОА. 

Современным общепризнанным и рекомендованным рабочей группой OARSI FDA исследованием для оценки структурных изменений при ОА считается МРТ. Для оценки морфометрии хряща коленного сустава есть доказательства прогностической валидности этого метода с хорошим уровнем надежности. С помощью МРТ можно точно измерить изменения морфологии хряща в течение 12 месяцев для ОА коленного сустава. МРТ может дополнить результаты исследований в отношении повышения темпов утраты хрящевой ткани, в том числе при ОА более высокого рентген-класса. Также МРТ обладает способностью давать картину других тканей, что с учетом рекомендации рассматривать модификационную терапию в более широком контексте требует дальнейшей работы относительно количественной и предиктивной валидности внехрящевых изменений. В 2015 году было проведено исследование влияния глюкозамина сульфата и хондроитина сульфата на структурные изменения при ОА коленного сустава.

По данным количественной МРТ, у больных с этой патологией, принимавших глюкозамина сульфат и хондроитина сульфат, через 24 месяца наблюдалось уменьшение потери объема хряща в отдельных регионах. Это регистрировалось как на фоне приема НПВС (у больных с меньшим сужением ШСЩ), так и без их приема (у больных с большим сужением ШСЩ). Эти данные свидетельствуют о болезнь-модифицирующем эффекте хондропротекторов, который не идентифицируется рентгенографически. Таким образом, количественная МРТ является на сегодняшний день наиболее чувствительным методом оценки эффективности препаратов, ее результаты не всегда коррелируют с рентгенографическими данными. Применение МРТ позволяет на качественно новом уровне доказательности демонстрировать наличие или отсутствие влияния лечения на деградацию хряща. Однако известно о существовании определенной диссоциации между морфологическими изменениями хряща и клиническими проявлениями суставного синдрома. У некоторых больных при наличии структурных изменений хряща отсутствуют клинические проявления, и наоборот, при выраженном клинически суставном синдроме не определяются морфологические изменения хрящевой ткани.
В этой связи актуальным остается определение биомаркеров хряща. Основными лимитирующими факторами их использования являются отсутствие линейной зависимости концентрации биомаркеров и изменений структурных параметров, а также взаимосвязь маркеров ОА с не зависящими от ОА возрастными изменениями. Проведено большое количество исследовательских работ, в которых в качестве биомаркеров хрящевой ткани рассматривались различные вещества. По их результатам среди множества биомаркеров наиболее информативным для оценки прогрессирования ОА коленных суставов в клинических условиях признано определение С-телопептида коллагена II типа в моче и олигомерного матриксного протеина хряща в сыворотке крови.

Таким образом, на сегодняшний день необходимо дальнейшее проведение клинических исследований на новом методическом уровне для оценки структурно-модифицирующего действия препаратов для лечения ОА.

В частности, в одном из таких исследований изучался модифицирующий эффект препарата Пиаскледин-300. Он представляет собой комплекс неомыляемых фитостеролов (ASU). Препарат выпускается французской компанией Laboratoires EXPANSCIENCE в капсулах и рекомендован к приему во время еды 1 раз в сутки в течение 3–6 месяцев. 

По данным, зафиксированным исследователями, было выявлено влияние ASU на выработку металлопротеиназ (ММР), цитокинов (IL-6, IL-8), простагландина (PGE2) (рис. 1), а также способность Пиаскледина ингибировать продукцию провоспалительных медиаторов (рис. 2). Также было обнаружено, что этот препарат вызывает значительное повышение уровня ТФР-1b в синовиальной жидкости коленных суставов при использовании разных дозировок (рис. 3).

Более детально о клиническом применении Пиаскледина рассказал в своем докладе «Эффективная и рациональная терапия остеоартроза: что предпочесть?» д.м.н. Д.Г. Рекалов.

На сегодняшний день тактика терапии больных с ОА включает в себя несколько составляющих. Начинать терапию целесообразно все же с нефармакологических методов лечения. Больным рекомендуют физическую активность, коррекцию массы тела, физиотерапию, психосоциальное воздействие, ортопедические пособия. Однако в клинической практике эти рекомендации крайне редко соблюдаются пациентами, что вынуждает обращаться к применению медикаментозных средств. Наиболее часто в терапии ОА используются анальгетики, пероральные НПВС и медленнодействующие болезнь-модифицирующие препараты из группы хондропротекторов. На сегодняшний день есть доказательная база для использования хондроитина сульфата, который обладает эффективностью при лечении начальных и умеренных проявлений ОА. Величина анальгетического эффекта его колеблется в диапазоне от малого до умеренного, по данным длительных наблюдений, он обладает структурно-модифицирующим и симптом-модифицирующим действием. Не так давно на украинском рынке появился препарат неомыляемых соединений сои и авокадо (ASU) — Пиаскледин-300. Первое упоминание об использовании этого соединения относится к 50-м годам прошлого века, когда его применение было признано эффективным при лечении патологии кожи и хряща при склеродермии.

В 1970-х годах ASU определены как вещества, активирующие эпидермис, мукозный и коллагеновый слой кожи и кости, а также обнаружен их анальгетический эффект при ОА тазобедренного сустава и способность замедлять прогрессирование заболевания. Действие ASU обусловлено их способностью повышать экспрессию трансформирующего фактора роста 1 и 2 и ингибитора тканевого плазминогена. ASU стимулируют синтез протеогликанов и образование коллагеновых волокон, ингибируют и блокируют продукцию интерлейкина-1β, 

одного из цитокинов, вызывающих быструю деструкцию костной и хрящевой ткани, что приводит к необратимым изменениям у пациентов с ОА. Кроме того, оказывая опосредованный коллагенолитический эффект на хондроциты и синовиоциты, они угнетают синтез ходроцитами коллагеназы, стромелизина, интерлейкина-6 и -8, а также простагландина Е2. Докладчик привел данные основных клинических исследований эффективности и безопасности ASU. Впервые симптом-модифицирующее действие этого вещества было показано в 1998 году, когда был зафиксирован анальгетический эффект у пациентов с ОА, более чем в 2 раза превышающий плацебо, а также снижение ограничения функциональной активности больных. Причем выявлялось потенцирование эффекта к 6-му месяцу терапии с периодом последействия 2 месяца после отмены препарата (рис. 4). Также в исследовании эффективности и безопасности ASU с участием 164 пациентов с ОА коленного и тазобедренного сустава использование Пиаскледина-300 в комбинации с НПВС после 45 дней терапии позволило снизить дозировку последних, необходимую для купирования симптомов заболевания, что уменьшало выраженность побочных явлений от приема НПВС. Среднесуточная доза НПВС в группе, получающей Пиаскледин-300, от начала лечения до 45-го дня составляла в среднем 75 ± 59 мг и 26 ± 38 мг. В группе плацебо эти цифры составили соответственно 78 ± 45 мг и 50 ± 48 мг. Общая доза полученного НПВС в группе Пиаскледина составила 372 ± ± 742 мг, а в группе плацебо — 814 ± 1026 мг. 

Структурно-модифицирующее действие ASU при коксартрозе, проявляющееся в замедлении деструкции хряща и прогрессирования сужения суставной щели, было доказано в крупномасштабных исследованиях Lequence et al. в 2002 году и E. Maheu et al. в 2009 году. По результатам этих работ после двух лет терапии Пиаскледином у пациентов с выраженным коксартрозом отмечалось в 2 раза меньшее сужение суставной щели, чем в группе плацебо. После трех лет терапии в исследовании ERADIAS уменьшение количества пациентов с сужением суставной щели в группе ASU в сравнении с группой плацебо составило 50 % (рис. 5). Данные исследований, подтверждающих эффективность Пиаскледина, позволили рекомендовать его как структурно-модифицирующий препарат для лечения ОА. Также был проведен метаанализ 4 крупных рандомизированных исследований с участием в общей сложности 600 пациентов, который показал, что частота развития побочных эффектов в группе Пиаскледина и в группе плацебо не имела достоверных различий, что говорит о высоком индексе безопасности применения ASU.

Таким образом, с учетом клинических и экспериментальных данных использование медленнодействующих болезнь-модифицирующих препаратов как стандартного лечения ОА является необходимой и эффективной составляющей терапии. В качестве препаратов первой линии следует использовать оригинальные молекулы, включенные в стандарт лечения и рекомендованные EULAR и OARSI. Клинически подтвержденная данными рандомизированных исследований эффективность и безопасность, наличие структурно- и симптом-модифицирующего действия Пиаскледина-300 позволяет применять его (в сочетании с парацетамолом при необходимости) в качестве терапии первой линии для лечения ОА.

В Украине также было проведено открытое многоцентровое исследование эффективности и безопасности базисной терапии ОА, о результатах которого рассказал в своем докладе д.м.н., профессор Института кардиологии им. Н.Д. Стражеско О.П. Борткевич. Целью исследования была оценка эффективности и переносимости неомыляемых соединений сои и авокадо, а именно препарата Пиаскледин-300, у пациентов с ОА коленных и тазобедренных суставов. Исследование проходило на базе 8 центров Украины. В него были включены амбулаторные или стационарные больные — мужчины и женщины в возрасте от 40 до 70 лет с первичным гонартрозом или коксартрозом 1–3-й рентгенологической стадии. Также критериями включения пациентов в исследование были наличие клинически значимых проявлений заболевания, индекс интенсивности боли в суставах ≥ 30 мм, индекс Лекена ≥ 5 баллов, необходимость приема НПВС на протяжении последних 5 месяцев и отсутствие использования каких-либо препаратов с хондропротекторной активностью в течение последних 3 месяцев. Из исследования были исключены пациенты, имеющие один из нижеперечисленных факторов: вторичный ОА; клинически латентный период заболевания; наличие язвенной болезни желудка или двенадцатиперстной кишки; тяжелая гепатоцеллюлярная или почечная недостаточность; тяжелое течение других острых или хронических заболеваний; индивидуальная непереносимость препарата, аллергия на препарат; тяжелые соматические заболевания (тяжелые формы ИБС, онкопатология, хроническая легочная недостаточность, ВИЧ). Критериями оценки эффективности были стандартные для подобных видов исследования показатели, а именно интенсивность боли в покое и при движении, длительность и интенсивность утренней скованности, динамика суммарного индекса Лекена, динамика функциональной недостаточности (WOMAC) и суточная потребность в НПВС. Общая оценка эффективности лечения проводилась пациентом и врачом. Переносимость препарата оценивалась по наличию и степени выраженности побочных эффектов. Контроль состояния пациентов осуществлялся через 1, 3 и 5 месяцев терапии. 

В исследовании принял участие 141 пациент — 102 женщины и 39 мужчин, средний возраст которых составил 60,20 ± 8,44 года. 114 больных страдали гонартрозом, у 43 пациентов был диагностирован коксартроз. Вторую и третью рентгенологические стадии имели 98 и 43 пациента соответственно. Большинство больных (131 человек) нуждались в постоянном использовании НПВС. Начальные средние значения оцениваемых показателей составляли: индекс боли в покое 37,86 ± 7,60; индекс боли при движении 44,63 ± 8,10; утренняя скованность (мин) 16,41 ± 5,40; утренняя скованность (интенсивность) 32,48 ± 5,90; индекс Лекена 9,7 ± 2,6; индекс WOMAC суммарный 265,0 ± 42,4 мм.

Оценка результатов показала достоверную эффективность Пиаскледина-300. Динамика оцениваемых показателей через 1, 3 и 5 месяцев лечения приведена в табл. 1.

Индекс боли в покое за 5 месяцев терапии уменьшился на 46 %, при этом улучшение отмечалось у 119 пациентов. Уменьшение длительности и интенсивности утренней скованности на 29 и 27 % соответственно наблюдалось более чем у 100 пациентов. Индекс Лекена снизился на 31 % через 5 месяцев лечения, улучшение этого показателя отмечалось у 105 больных. Индекс WOMAC суммарный снизился на 41 %, улучшение зафиксировано у 95 пациентов. Следует отметить, что положительная динамика всех показателей была равномерной от первого к пятому месяцу лечения. Если в начале терапии только 7 % больных могли обходиться без постоянного приема НПВС, то через месяц эта цифра увеличилась до 16,3 %, через 3 месяца — до 26,25, а через 5 месяцев 47,5 % больных не принимали НПВС. Также было отмечено снижение необходимой эффективной дозы этих препаратов на фоне приема Пиаскледина-300. После 5 месяцев лечения дозировка НПВС составляла 28 % от первоначальной дозы. Через 5 месяцев лечения более 120 человек отметили значительное улучшение состояния на фоне приема Пиаскледина-300, 15 человек отметили улучшение и только 3 пациента пришли к выводу, что их состояние осталось без изменений. Оценка врача незначительно отличалась от мнения пациентов. 

За время исследования было зафиксировано 3 случая возникновения побочных эффектов: две аллергические реакции по типу крапивницы, которые купировались приемом противоаллергических препаратов в течение 5–7 дней, и один эпизод появления боли в животе, который купировался самостоятельно.

В настоящий момент исследование продолжается, по результатам оценки данных после пятимесячного наблюдения специалистами был сделан вывод, что Пиаскледин-300 обладает симптом-модифицирующим действием, является эффективным для лечения больных ОА коленного и тазобедренного суставов. Механизм действия, высокая эффективность, удобство использования и хорошая переносимость препарата, минимальные противопоказания позволяют рекомендовать и использовать его в качестве базисного средства для лечения остеоартроза. 

ПИАСКЛЕДИН: аналоги, дженерики, синонимы, дешевые аналоги

ПИАСКЛЕДИН: аналоги, дженерики, синонимы, дешевые аналоги – Medcentre. com.ua

от 175 грн

Противовоспалительный препарат Мукосат назначают пациентам при дегенеративно-дистрофических заболеваниях суставов и позвоночника: первичный артроз, остеоартроз с преимущественным поражением крупных суставов, межпозвонковый остеохондроз

от 539 грн

Дона – средство, влияющее на обмен в хрящевой ткани. Восполняет естественный дефицит глюкозамина, стимулирует синтез протеогликанов и гиалуроновой кислоты синовиальной жидкости.

от 38 грн

Комплексный препарат Нимид оказывает аналгетическое, жаропонижающее и противовоспалительное действие.

от 288 грн

Препарат Терафлекс комбинированное лекарство-хондропротектор, стимулирует образование хрящевого матрикса, замедляет разрушение хряща, применяется в комплексной терапии патологий опорно-двигательного аппарата.

от 670 грн

Лекарственный препарат Артрадол, на основе хондроитина сульфат, способствует коррекции метаболизма костной и хрящевой ткани.

от 750 грн

Препарат Драстоп тормозит процесс дегенерации хрящевой ткани, стимулирует процессы регенерации суставного хряща, способствует восстановлению суставной сумки.

от 123 грн

Противоревматический препарат Синарта стимулирует синтез гликозаминогликанов и суставных протеогликанов, предназначен для лечения симптомов остеоартрита: боли и функционального ограничения.

от 355 грн

Препарат Артрон Комплекс стимулирует регенерацию хрящевой ткани, улучшает подвижность суставов, устраняет болевой синдром, вызванный заболеваниями опорно-двигательного аппарата.

от 22 грн

Лекарственный препарат Нимесулид оказывает выраженное противовоспалительное, а также анальгетическое и в меньшей степени жаропонижающее действие.

от 63 грн

Препарат Глюкозамин – хондропротектор, активирует обменные процессы в хрящевой ткани, способствует торможению развития дегенеративных процессов в суставах.

от 59 грн

Препарат Найз – противовоспалительное лекарственное средство применяемое для симптоматического лечения, уменьшения интенсивности боли при болях в суставах, зубной боли, головной боли.

от 63 грн

Препарат Артифлекс влияет на обмен в хрящевой ткани, восполняет эндогенный дефицит глюкозамина, стимулирует синтез протеогликанов гиалуроновой кислоты синовиальной жидкости.

от 600 грн

Препарат Структум влияет на обменные процессы в гиалиновом и волокнистом хрящах, уменьшает дегенеративные изменения в хрящевой ткани суставов, стимулирует биосинтез гликозамингликанов.

от 10 грн

Препарат Нимесил – ненаркотическое обезболивающее, жаропонижающее и противовоспалительное средство. Благодаря своей эффективности, Нимесил заслужил очень большое количество положительных отзывов.

от 173 грн

Препарат Мовекс Комфорт оказывает хондропротекторный эффект, является субстратом построения суставного хряща и стимулирует регенерацию хрящевой ткани.

от 51 грн

Препарат Хондра-Сила замедляет прогрессирование остеоартроза, уменьшает выраженность воспаления и боли в пораженных суставах, нормализует отложение кальция в костной ткани.

от 22 грн

Противовоспалительный препарат Нимесин оказывает обезболивающее действие, применяется для лечения воспалительных заболеваний опорно -двигательного аппарата, боли различного генеза.

от 76 грн

Противовоспалительный препарат Синметон оказывает анальгетическое и антипиретическое действие, угнетает экссудативные и пролиферативные процессы в очаге воспаления, снижает уровень брадикинина и гистамина, а также повышает порог чувствительности болевых рецепторов. Хондроксид Форте – препарат, стимулирующий процесс регенерации хрящевой ткани, с противовоспалительным действием, обладает комбинированным действием.

от 54 грн

Препарат Артросан – эффективное средство, которое рекомендуется к применению при лечении артритов, для снятия отеков суставов, оказывает противовоспалительное действие, согревающее и обезболивающее.

от 328 грн

Препарат Хондросат является лекарственным средством, которое применяется в лечении дегенеративно-дистрофических заболеваний опорно-двигательного аппарата. Препарат Артродар – это лекарственное средство, разработанное для лечения остеоартрита, который имеет анальгезирующее, антипиретические и противовоспалительные свойства.

от 192 грн

Препарат Артифлекс Плюс – это хондропротектор, нестероидное противовоспалительное лекарственное средство, которое применяется для лечения дегенеративно-дистрофических заболеваний суставов и позвоночника.

от 25 грн

Апонил – противовоспалительный и анальгетический препарат, предназначен для терапии пациентов, страдающих болевым синдромом различной этиологии.

от 300 грн

Нимулид – ненаркотическое противовоспалительное средство (НПВС) класса сульфонанилидов, селективный ингибитор ЦОГ-2. Оказывает противовоспалительное, обезболивающее, жаропонижающее действие.

от 96 грн

Препарат Роксид эффективен при лечении инфекционных заболеваний, таких как: лор-заболевания, половых инфекциях, моче-половых заболеваниях

от 1100 грн

Эльбона раствор способствует предотвращению процессов разрушения хряща, стимулирует восстановление хрящевой ткани. Улучшает подвижность суставов.

от 611 грн

Артрон Хондрекс – хондропротекторный препарат, регулирует фосфорно-кальциевый обмен, улучшает структуру хрящевой ткани, стимулирует выработку внутрисуставной жидкости, принимает участие в синтезе гиалуроновой кислоты.

от 900 грн

Диафлекс – нестероидный противовоспалительный препарат, предназначен к применению для лечения первичного и вторичного остеоартроза, оказывает анальгезирующее действие.

от 56 грн

Фитокомплекс Артросан-спорт рекомендуется употреблять как пищевой продукт к рациону питания при нагрузках на опорно-двигательный аппарат и растяжении сухожилий. Препарат Амеолин – нестероидное противовоспалительное средство, применяемое для лечения боли при заболеваниях опорно-двигательного аппарата: ревматические заболевания, также при лихорадке, дисменорее.

от 291 грн

Препарат Немулекс оказывает противовоспалительное, анальгезирующее, жаропонижающее и антиагрегантное действие, предназначен для симптоматической терапии, уменьшая боли и воспаление.

от 282 грн

Аффида Форт – гранулы для приготовления суспензии, применяется в лечении острой боли, первичной дисменореи, оказывает противовоспалительное действие. Препарат Хондроитин-АКОС применяется для лечения дегенеративных заболеваний суставов и позвоночника: остеоартроз, остеохондроз позвоночника.

от 39 грн

Препарат Хондроитин выпускается в виде капсул, геля, гель-бальзама, применяется в лечении и профилактике дегенеративно-дистрофических заболеваний суставов и позвоночника.

от 17 грн

Сиган – комбинированный препарат, эффект которого обусловлен действием компонентов, входящих в его состав.

от 850 грн

Препарат Артрокер – лекарственное средство, применяется при первичном и вторичном остеоартрозе, оказывает противовоспалительное действие. Препарат Диартрин является нестероидным противовоспалительным лекарственным средством, применяется в симптоматическом лечении остеоартроза тазобедренных и коленных суставов. Препарат Артролек является противоревматическим лекарственным средством, применяется для облегчения симптомов (от легкой до умеренной боли) при подтвержденном диагнозе остеоартрита коленного сустава.

от 300 грн

Препарат Стопартроз является лекарственным препаратом, который стимулирует процесс регенерации хрящевой ткани и используется облегчения легкой и умеренно выраженной боли при остеоартрозе коленного сустава. Препарат Нимесубел – нестероидное противовоспалительное средство, предназначен для симптоматической терапии, уменьшения боли и воспаления на момент использования, на прогрессирование заболевания не влияет. Препарат Артрафик – мазь для наружного применения, применяется в лечении и профилактике остеохондроза, остеоартроза периферических суставов и позвоночника.

от 58 грн

Ремесулид является нестероидным противовоспалительным (НПВП) и противоревматическим фармсредством. Оказывает противовоспалительные, жаропонижающие и анальгезирующие эффекты. Вольтафлекс – обезболивающий и противовоспалительный препарат, который позволяет восстановить гибкость коленных суставов, улучая их подвижность.

от 424 грн

от 132 грн

от 32 грн

Препарат Фаниган оказывает обезболивающее, противовоспалительное и противоотечное действие. Устраняет боль и воспаление суставов, уменьшает утреннюю скованность и припухлость суставов, способствует увеличению объема движений в суставах.

от 56 грн

Препарат Ксефокам (Лорноксикам) оказывает анальгезирующее и противовоспалительное действие. Ксефокам применяется при болевом синдроме средней и тяжелой степени (боли в мышцах, радикулярные боли, боли в позвоночнике, послеоперационный период), воспалительных и дегенеративных болезнях опорно-двигательного аппарата (ревматические поражения).

от 15 грн

Препарат Диклофенак натрия оказывает противовоспалительное, анальгезирующее и жаропонижающее действие

от 87 грн

Лекарственный препарат Диклоберл эффективен при подагре, хронических артритах, ревматических поражениях мягких тканей, острых артритах

от 17 грн

Препарат Ибупрофен (Ibuprofen) оказывает противовоспалительное, анальгезирующее и жаропонижающее действие.

от 4 грн

Противовоспалительный препарат Ортофен назначают при лечении воспалительных процессов в суставах, пр ревматизме, артрите, артрозе, при заболеваниях позвоночника.

от 102 грн

Препарат Мелбек назначают при остеоартрозе, остеоартрите, дегенеративных заболеваниях суставов, ревматоидном артрите, анкилозирующем спондилите, посттравматической боли.

от 25 грн

Противовоспалительный препарат Индометацин эффективен при заболеваниях опорно-двигательного аппарата, артрите, подагре, болезнях суставов, и других заболеваниях, сопровождающихся воспалением.

от 65 грн

Ибуфен для детей – нестероидное противовоспалительное средство для детей, оказывает жаропонижающее, обезболивающее действие. Применяется при повышенное температуре, для устранения болевого синдрома.

от 50 грн

Препарат Кетанов оказывает противовоспалительное и выраженное анальгезирующее действие. Механизм действия обусловлен ингибированием фермента циклооксигеназы и торможением синтеза простагландинов. Кетанов не оказывает седативного действия, не влияет на опиоидные рецепторы. Кетанов не вызывает угнетение дыхательного центра и не оказывает влияния на психомоторные функции.

от 187 грн

Препарат Мовалис оказывает противовоспалительное, анальгезирующее и жаропонижающее действие. Выраженное противовоспалительное действие мелоксикама установлено на всех стандартных моделях воспаления.

от 34 грн

Препарат Мефенаминка – противовоспалительное лекарственное средство, применяется для лечения ОРЗ, гриппа, вирусных инфекций, для устранения болевого синдрома средней и интенсивной тяжести.

от 117 грн

Препарат Аэртал (Airtal) оказывает противовоспалительное, жаропонижающее и обезболивающее действия.

от 68 грн

Препарат Кейвер является противовоспалительным, обезболивающим и жаропонижающим лекарственным средством, которое применяется для лечения болевого синдрома.

от 178 грн

Противовоспалительный препарат Дексалгин инъект, оказывает анальгезирующее, противовоспалительное и жаропонижающие действие, применяется для купирования болевого синдрома различного генеза.

от 49 грн

Имет содержит активное вещество – ибупрофен – производное фенилпропионовой кислоты, состоящее из рацемической смеси R- и S-энантиомеров. Имет обладает противовоспалительной, анальгетической и антипиретической активностью.

от 550 грн

Препарат Хондролон оказывает стимулирующее регенерацию хрящевой ткани действие, происходит снятие воспалительного процесса, уменьшение болевых ощущений за счет предотвращения воздействия агрессивных молекул цитокинов.

от 159 грн

Препарат Протекон – комбинированный хондропротектор, средство, применяемое при заболеваниях опорно-двигательного аппарата, показан при остеоартрозах любой локализации.

от 262 грн

Препарат Протекта оказывает хондропротекторный и остеотропный эффекты, стимулирует синтез коллагена, благоприятно влияет на метаболизм хряща, проявляет умеренное противовоспалительное действие.

от 95 грн

Препарат применяется при лечении и профилактике остеохондроза позвоночника и остеоартроза периферических суставов. Препарат Артрофиш – натуральный комплекс из хрящевой ткани морских организмов, эффективен в качестве общеукрепляющего средства при повышенных нагрузках на опорно-двигательный аппарат.

от 750 грн

Препарат Артракам – содержит глюкозамина сульфат, который является главным компонентом лекарственного препарата, способствует торможению развития дегенеративных процессов в суставах.

от 860 грн

Хондроксид Максимум – препарат с улучшающим регенерацию хрящевой ткани и противовоспалительным действием для наружного применения.

от 88 грн

Бутадион – мазь для наружного применения, оказывает анальгезирующее, противовоспалительное действие при воспалении мягких тканей и суставов. Кондронова – препарат, который стимулирует регенерацию хрящевой ткани, содержит глюкозамин и хондроитина сульфат, которые принимают участие в синтезе соединительной ткани, способствуя предотвращению процессов разрушения хряща.

от 293 грн

Препарат Тексамен оказывает выраженный противовоспалительный, обезболивающий и жаропонижающий эффект, применяют для терапии пациентов, страдающих дегенеративными и воспалительными заболеваниями костно-мышечной системы.

от 214 грн

Препарат Флекцерин – противовоспалительное средство в лечении ревматических заболеваний суставов. Применяется в лечении остеоартрита и остеоартроза. Хондрофлекс – препарат, стимулирующий восстановление хрящевой ткани, предназначен для лечения остеоартроза периферических суставов и суставов позвоночника I-III степени.

от 1010 грн

Препарат Аркоксиа применяется в симптоматической терапие остеоартроза, ревматоидного артрита, анкилозирующего спондилита, болей и воспалительной симптоматики, связанной с острым подагрическим артритом. Препарат Хондроглюксид стимулирует регенерацию хрящевой ткани, оказывает противовоспалительное и обезболивающее действие, применяется при остеоартрозе (в том числе суставов и позвоночника I-III ст.).

от 67 грн

Артрикюр – комбинированный растительный аюрведический препарат, в состав которого входят растения, проявляющие свою эффективность при лечении заболеваний опорно-двигательной системы. Препарат Бриония – гомеопатическое средство, благотворно воздействует на синовиальные и серозные оболочки, легкие, плевру, брюшину, печень, мышечную ткань. Показать еще
Всего найдено 64 аналога ПИАСКЛЕДИН , из которых дешевые аналоги – НИМЕСИЛ (10 грн. ) и СИГАН (17 грн.) , популярные аналоги – МУКОСАТ и ДОНА

ПИАСКЛЕДИН отзывы

САМОЛЕЧЕНИЕ МОЖЕТ НАВРЕДИТЬ ВАШЕМУ ЗДОРОВЬЮ

Остеоартроз: старая болезнь в новом свете | Советы специалистов | Тематические страницы

Остеоартроз: старая болезнь в новом свете

Ревматизм и не только

Долгое время почти все заболевания суставов называли ревматизмом (кроме разве что подагры). С развитием науки выяснилось, что боли в суставах могут быть вызваны самыми разными процессами и лечить их тоже следует неодинаково. Ревматизм – только одна из многих болезней, однако по традиции все нетравматические поражения суставов до сих пор часто называют ревматическими заболева ниями. И даже институт, который занимается любыми суставными болезнями, по-прежнему называется НИИ ревматологии.

Один из видов поражений суставов, который встречается очень часто в пожилом возрасте, вызывается нарушениями обмена веществ. В медицине принято все обменные заболевания называть по органу, в котором они развиваются, добавляя в конце -оз. В данном случае из греческого arthron (сустав) получилось артроз.

Затем выяснилось, что, хотя начало таких заболеваний суставов лежит действительно в обменных нарушениях, потом к ним обязательно присоединяется воспаление. Сильные боли, с которыми обычно человек обращается к врачу, свидетельствуют именно об этом. А все воспалительные заболевания в медицине принято называть по пораженному органу, добавляя в конце -ит. Поэтому было предложено переименовать артроз в обменный артрит. Однако новое название пока не прижилось.

Появилось еще одно название – остеоартроз (в зарубежной литературе – остеоартрит). Оказалось, что при этой болезни всегда поражены не только ткани суставной сумки, хрящ, но и кость. Так что если вы видите диагнозы артроз, обменный артрит, остеоартроз, остеоартрит, будьте уверены: это одно и то же. Диагнозы меняются, а проблема все та же. Видите на улице летом пожилого человека с тростью – это остеоартроз. Он особенно характерен для пожилых (хотя встречается и у молодых) и чаще всего поражает коленные и тазобедренные суставы.

Что же происходит в суставе при остеоартрозе?

Хрящ устроен сложно. Его клетки (хондроциты) погружены в волокнистое вещество, которое они сами нарабатывают. Именно оно и определяет устойчивость хряща к нагрузкам. У него сложный состав: это агрегаты протеогликанов – особых веществ с очень длинной молекулой.

С возрастом этого сложного вещества начинает синтезироваться меньше. Изменяется состав протеогликанов, они распадаются. Активизируются расщепляющие эти обломки ферменты. Мало того что синтез уменьшается, так еще и распад увеличивается. Хрящ становится менее устойчивым к физическим нагрузкам. На нем появляются трещины. Из-за нарушенной структуры и функции хрящей поражаются и прилегающие к ним участки кости. Обломки собственных молекул воспринимаются организмом как чужеродные, и иммунная система активизируется против суставных тканей. Начинается воспаление.

Образуется порочный круг, то есть процесс сам себя стимулирует. Если не принимать меры, то он будет раскручиваться по нарастающей. Для далеко зашедшего остеоартроза характерны такие грубые анатомические изменения, как кисты в костной ткани под хрящом, склероз (разрастание рубцовой ткани) и остеофиты.

Остеофиты – это те шишечки и бугорочки, которые иногда можно прощупать. Они могут образовываться по краям суставных поверхностей. В народе этот процесс нередко называют отложением солей. Конечно, никакие соли в суставах не откладываются. Эти выпуклости – результат патологического, чрезмерного ресинтеза костной ткани взамен погибшей. Организм кое-как латает ее. Состоят остеофиты из костной и соединительной (рубцовой) тканей, а сверху они покрыты волокнистым хрящом. Рассасываться такое образование не может. В результате пациента беспокоит боль, мешает и уродует ногу деформация.

Однако не все пожилые люди страдают от этого заболевания, а иногда ему подвержены и довольно молодые. Что же способствует развитию выраженного остеоартроза?

Факторы риска

Есть причины, воздействовать на которые мы не можем. Это старение и наследственная предрасположенность. Если ваши родственники страдали в пожилом возрасте болями в суставах, то принимайте все возможные меры заранее, чтобы не повторить их судьбу.

Но есть и другие факторы риска развития остеоартрозов, о которых стоит задуматься всем.

1. Чрезмерные нагрузки на суставы. Это в первую очередь лишний вес. Затем – частое ношение тяжелых сумок и других тяжестей. (Пользуйтесь сумками на колесиках, а огород поливайте из шланга.) Другие факторы: длительные периоды стояния на ногах, резкие прыжки и бег по твердым покрытиям и в неподходящей обуви.

2. Венозный застой. Причины этого явления – варикозное расширение вен голеней, травматическое повреждение вен. Костная ткань даже больше, хотя и менее заметно, страдает от венозного застоя, чем отекающая подкожная клетчатка. Если отток крови нарушен, в мягких тканях жидкость может уходить в эти ткани. в твердой кости ей уйти некуда, давление в костных венах сильно повышается. В ткани поступает меньше кислорода, плохо выводятся продукты обмена. В такой ситуации надо консультироваться и вовремя лечиться у флебологов (специалистов по заболеваниям вен). Вредно носить носки с тугими резинками и гольфы.

3. Гипертоническая болезнь. Точные причины такой зависимости пока не установлены, однако статистика однозначно ее подтверждает. Чтобы в пожилом возрасте не болели суставы, нужно, даже если вес в норме, следить за артериальным давлением и при необходимости его корректировать. Если процесс не зашел слишком далеко, при нормализации давления боли в суставах уменьшаются.

4. Нарушение микроциркуляции крови. Если оно и не является причиной остеоартроза, то ускоряет его прогрессирование. Поэтому при заболеваниях, вызывающих подобное нарушение (в частности, при сахарном диабете), надо периодически проводить курсы терапии для улучшения микроциркуляции крови.

5. Повышение свертывающей способности крови и нарушение липидного обмена (уровня холестерина и т. п.). Что здесь причина, а что следствие – пока неясно. Но известно, что при восстановлении нормы в коагулограмме и липидном профиле крови (особенно это касается липидного профиля) боли в суставах уменьшаются. Так что при болях в коленях надо не только соблюдать диету с минимумом животных жиров, но и сделать анализ состояния свертывающей системы и липидного профиля крови.

6. Потеря сократительной способности мышц вокруг сустава ведет к деградации хряща. Поэтому остеоартроз может развиться и при недостатке физической активности или малом ее разнообразии. Часто мыть полы недостаточно – нужна легкая гимнастика с тренировкой всех суставов.

7. Прием глюкокортикостероидных гормонов, злоупотребление алкоголем, аутоиммунные заболевания предрасполагают к остеоартрозу.

8. Травмы, перенесенные когда-то, могут давать начало остеоартрозу.

Советы больным и здоровым

Игнорировать остеоартроз нельзя. Далеко зашедший процесс не ведет к фатальному исходу, но очень омрачает жизнь. Беспокоят боли, которые усиливаются, может возникнуть ограничение подвижности в больных суставах. При появлении симптомов нужно обращаться к ревматологу или артрологу.

Для профилактики и на начальных стадиях рекомендуются ежедневные прогулки не менее 20-30 минут и налегке. Желательно постепенное увеличение длительности и частоты прогулок до 50-60 минут 5-6 дней в неделю.

1-2 раза в неделю выполняйте силовые упражнения – подъем по ступеням. Полезны велосипед, лыжи, плавание.

В далеко зашедших стадиях полезна специальная гимнастика с ежедневным большим количеством движений в больных суставах, но очень маленькой амплитуды – практически дрожание.

При излишней полноте необходимо снизить вес.

При сильных болях суставы желательно немного разгружать – носить эластичные надколенники (ортезы или более сложные приспособления). Ходить на значительные расстояния с тростью.

При плоскостопии лучше носить ортопедическую обувь, но необходима хотя бы однократная консультация специалиста. В одних случаях нужны стельки-супинаторы, в других – клиновидные стельки, а иногда их необходимо изготовить индивидуально.

Лекарственную терапию тоже должен назначать специалист. Основные препараты для лечения остеоартроза – из группы нестероидных противовоспалительных средств (НПВС). Для хорошего эффекта они должны применяться долго и могут вызывать серьезные осложнения. К сожалению, чем препарат этой группы эффективнее, тем вероятнее осложнения. Специалист подскажет – может быть, частично их можно будет применять местно. Самолечение НПВС опасно.

Существуют хондропротекторы в виде биологически активных добавок. Большинство исследований показали их бесполезность, хотя есть ученые, считающие, что некоторый эффект достигается. Правда, наступает он в лучшем случае через месяц после начала приема, а максимальный – через три месяца. Тот же автор пишет, что еще через три месяца, если не принимать эти БАДы постоянно, эффект исчезает. В той же относительно оптимистичной работе есть еще одно наблюдение. Оказывается, в 10% случаев от приема хондропротекторов может наступить ухудшение. Это много. Где гарантия, что вы не попадете в эти 10%?

Ухудшение из-за хондопротекторов объясняется тем, что при запущенном процессе с большим количеством продуктов распада тканей в патологическом очаге появляется аутоиммунный компонент – агрессия иммунной системы к собственной хрящевой ткани. А хондропротекторы как элементы чужой хрящевой ткани эту агрессию усиливают.

Исследователи постоянно пытаются разработать новые лекарства от остеоартроза. Сейчас в процессе изучения – препараты из авокадо, сои, корня имбиря (пиаскледин, зинаксин и др.). Если они действительно эффективны, то и сами эти продукты (соя, авокадо, имбирь) при остеоартрозе могут быть полезны.

Применяются и различные виды физиолечения, терапия холодом, иглоукалывание, массаж. Окончательно точка в поисках эффективных средств для лечения остеоартроза не поставлена.

Новое на сайте

Хондропротекторы

Хондропротекторы – это группа препаратов, которые оказывают стимулирующее воздействие на хрящевую ткань, способствуя её регенерации, а также тормозит последующее разрушение. Если у человека диагностируется артроз, это говорит о том, что в суставных тканях произошли дегенеративные изменения дистрофического характера, присутствует боль и без лечения это приведет к их деформации. Естественно, что при таких изменениях основное воздействие должно быть направлено на восстановление поврежденных тканей.

Хотя хондропротекторы – это препараты, направленные на восстановление хрящевой ткани, тем не менее, именно в случае артроза у многих пациентов возникают сомнения – стоит ли их употреблять. Подобное недоверие к данной группе лекарственных средств основано на том, что многие больные указывают на их низкую эффективность. Хотя существуют и защитники хондропротекторов, говорящие, что именно они помогли им в борьбе с недугом.

Существует несколько причин подобных разногласий:

  • Во-первых, не стоит надеяться на мгновенный результат. Эффект от приема препаратов будет заметен лишь спустя минимум 3 месяца, а может даже и через полгода (однако положительный эффект будет также продолжительным). Отклонения от схемы, предписанной врачом, недопустимы. Это является особенностью хондропротекторов, именно поэтому их относят классу средств длительного воздействия.
  • Во-вторых, помочь лекарства смогут лишь на тех этапах развития болезни, когда хрящ ещё не разрушен и имеет способность к восстановлению. Когда суставная щель полностью исчезнет, а хрящ пропадет, то хондропротекторы окажутся абсолютно бесполезными.

Именно поэтому ответ на вопрос о целесообразности приема данной группы препаратов во время артроза положительный. Но эффект будет заметен лишь в случае длительного приема средств на начальных этапах развития болезни.

Когда «работают» хондропротекторы?

 

  • Хондроитин и глюкозамин эффективны на1-2 стадиях артроза, когда еще нет разрушения хряща, и живы хондроциты.
  • Хондроитин сульфат – крупная молекула, крупнее глюкозамина примерно в 100 раз, поэтому его биодоступность составляет всего 13%.
  • Биодоступность глюкозамина составляет побольше, но тоже немного, всего 25%. То есть непосредственно до сустава дойдет 25% от принятой дозы.
  • Оптимальные лечебные дозировки хондропротекторов для приема внутрь, по мнению практикующих врачей, следующие: глюкозамин — 1000-1500 мг; хондроитин- 800-1000мг.
  • Для получения реального результата требуется2-3 курса лечения этими препаратами, на что требуется до 1,5 лет.
  • Практикующие врачи советуют принимать хондропротекторы 3-5 месяцев подряд и каждые полгода курс повторять.
  • Хондропротекторы должны приниматься регулярно, курсами, а не от случая к случаю.
  • Препараты хондропротекторы бессмысленно принимать, если продолжать издеваться над суставом чрезмерными нагрузками. Для достижения эффекта нужно снижать вес, а спортсменам отказаться от обычных тренировок.
  • Принимать эту группу можно очень долго и не видеть результата, если не обеспечить нормальное питание сустава. Для этого нужны специальные (!) упражнения.
  • Для производства хондроитина и глюкозамина используются хрящи крупного рогатого скота, экстракты из морских рыб. 100% очистки их добиться сложно, поэтому при приеме этих препаратов случаются аллергические реакции и проблемы со стороны ЖКТ (боли в животе, диарея, запор и прочее)
  • Хондроитинсульфатснижает свертываемость крови, поэтому его нельзя применять вместе с антикоагулянтами и при склонности к кровотечениям.
  • Препараты хондропротекторы отивопоказаны беременным, кормящим, детям.
  • Диабетикам при приеме этих средств нужно особенно тщательно контролировать уровень сахара. Он может повышаться.

Как работают хондропротекторы?

Основой любого препарата данного ряда является вещество, содержащееся в натуральной хрящевой ткани. Получают его из костной, либо хрящевой основы живых существ. Таковыми являются хондроитинсульфат и его предшественник глюкозамингликан.

Хондроитин сульфат оказывает следующее воздействие:

  • Способствует синтезу коллагена и протеогликана, благодаря чему образуются новые хондроциты.
  • Снижает активность ферментов, повреждающих хрящ
  • Улучшает анаболизм в хрящевой ткани.
  • Стимулирует выработку гиалуроновой кислоты, тормозит её преждевременный распад.
  • Улучшает качество и объем внутрисуставной жидкости.
  • Снимает воспаление, замедляет процесс разрушения хряща.

Глюказамин оказывает следующее воздействие:

  • Участвует в синтезе гепарина, гиалуроновой кислоты, хондроитина и прочих необходимых для нормального функционирования хряща веществ.
  • Стимулирует деятельность хондроцитов
  • Снимает воспаление, отечность, выступает в качестве антиоксиданта.
  • Способствует снижению деятельности катаболических ферментов, оказывающих разрушающее воздействие на сустав.

Подобный механизм воздействия хондропротекторов на сустав и обуславливает их терапевтических эффект в отношении артроза. Сочетание двух активных компонентов в разных препаратах может варьироваться, поэтому подбирать их и назначать дозировку может только врач

хондропротекторы хорошо переносятся большинством пациентов, а неприятные последствия возникают при действии на организм примесей и добавок, которые присутствуют в лекарственном веществе в разных количествах. Сами же действующие ингредиенты – хондроитин и глюкозамин близки человеческому организму по составу, поэтому безопасны. .

Препараты для приема внутрь:

  • дона,
  • структум,
  • артра,
  • пиаскледин,
  • терафлекс,
  • диафлекс

Они начинают оказывать желаемое действие на организм только спустя 3 месяца, и через 6 месяцев создается устойчивый эффект.

 

Альтернативой применению пероральных хондропротекторов является использование алфлутопа и препаратов гиалуроновой кислоты  для внутрисуставного введения. При этом достигается необходимая концентрация именно в целевом суставе, что обусловливает все более частое применение этого способа введения лекарственных средств при лечении остеоартроза коленных суставов .

 

Препараты инъекционного действия:

  • алфлутоп,
  • румалон
  • хондрогард
  • хондролон,

Эффект от их применения заметен быстрее, а курс лечения составляет не менее 10-20 процедур.

.

Заместители внутрисуставной жидкости:

  • ферматрон,
  • остенил,
  • гиалуром
  • синокром.

Это препараты на основе гиалуроновой кислоты, которые вводятся непосредственно в крупные суставы, к примеру, при гонартрозе. Они замещают собою внутрисуставную жидкость, выработка которой снижается при артрозах, и, дополнительно, обладают хондропротективным действием. Это полностью врачебная манипуляция, которую, может проводить только специалист в специально оборудованной манипуляционной. . Курс 3-5 процедур, повтор не ранее, чем через 6 -12 месяцев.

 

Препараты для наружного применения

     Хондроксид

     Хондроитин  и пр.

Препараты для наружного применения эффективны только в комплексе с другими формами выпуска.

 

 

 

 

 

ПИАСКЛЕДИН 300 отзывы врачей отрицательные и реальные, развод или правда, цена в аптеке на 2022 00:50

Приветствую всех посетителей нашего полезного сайта. В данном материале я бы хотела рассказать вам о таком препарате, как пиаскледин 300.

Пиаскледин 300: мой опыт использования

Хондропротектор Пиаскледин 300 является натуральным препаратом для лечения суставных заболеваний, в основе которых лежат натуральные растительные компоненты из авокадо и соевых бобов.

Данный препарат достаточно новый, на фармацевтическом рынке Российской Федерации он появился в 2008 году и всего за пять лет о нем накопилось недостаточно информации, но тем не менее она имеется.

Отзыв №1

Еще пару лет назад мне был поставлен диагноз гонартроз левого коленного сустава. Тогда у меня появились сильнейшие боли в области колена, когда я ходила. Причем боли были настолько сильные, что я даже прихрамывала. Весь этот период мне приходилось принимать анельгетики и нестороидные противовоспалительные средства. Причем было испробовано множество таких препаратов, но они не приносили особого эффекта.

Мой лечащий врач посоветовала пропить мне Пискледин 300, но предупредил, что курс лечения будет длительный, поскольку все хондропротекторы действуют не сразу. Я запаслась терпением и на протяжении шести месяцев пропила данный препарат.

Честно признаться, я была приятно удивлена результатами лечения. Приблизительно через двадцать дней болезненные ощущения уменьшились, а к шести месяцам лечебного курса боль пропала полностью.

Со времени окончания лечебного курса прошло два месяца, болезненные ощущения снова появились. Скорее всего необходимо снова что то пропить для суставов. Поэтому этим препаратом я довольна, очень благодарна врачу, который посоветовал это лекарственное средство.

Отзыв №2

Пиаскледин достаточно хороший препарат, который помог мне в кратчайшие сроки. Естественно этот препарат не может быть дешевым, и в целях экономии я принимала его не ежедневно, как написано в инструкции, а через день.

Не смотря на это препарат мне хорошо помог, и болезненные ощущения в суставах прошли. Кто то писал, что от препарата появилась боль в желудке, но такого априори быть не может, поскольку это препарат на основе растительных компонентов, а не нестероидное противовоспалительное средство.

Отзыв №3

Диагноз деформирующий остеортроз колена второй степени. Лечила я этот недуг у нашего врача. Он назначил мидокалм, найз и мазь кетонал, а также пять инъекций диклофенака на лечебный курс. Когда боли немного спадут, врач посоветовала пропить пиаскледин 300 для продолжительного приема. Лечебный курс данным препаратом должен был составлять шесть месяцев.

Что же я могу сказать про этот препарат. Болезненные ощущения уменьшились, но сказать чтобы совсем прошли – нет. Все равно во время приседания осталась боль в колене, ну и поясница чуть чуть побаливала.

На сегодняшний день я еще принимаю пиаскледин и думаю, может все таки следует подключить еще какой то препарат для лечения суставов. Наверное снова обращусь с этим вопросом к доктору.

Отзыв №4

У меня уже давно появились боли в спине, от которых не помогают никакие лекарственные препараты. Но четыре года назад сестра фармацевт посоветовала мне новый препарат пиаскледин. С того момента я принимаю его ежедневно время от времени приблизительно по два месяца.

Я заметила что боли в спине действительно уменьшились и мне даже не приходилось принимать обезболивающие средства. Очень благодарна производителю, который помог мне справиться с такой сильной болью. Теперь я советую препарат всем знакомым.

Надеюсь этот материал был полезен для вас и вы почерпали из него интересующую информацию.

Будьте здоровы!

Перед применением обязательно проконсультируйтесь со специалистом


Видео обзор

Все(5)

Сравнение эффективности пиаскледина и трансформирующего фактора роста β1 в отношении хондрогенной дифференцировки стволовых клеток, полученных из жировой ткани человека, в фибриновых и фибрин-альгинатных каркасах

Иран J Basic Med Sci. 2018 февраль; 21(2): 212–218.

Batool Hashemibeni

1 Кафедра анатомических наук, Медицинская школа, Исфаханский университет медицинских наук, Исфахан, Иран

Ali Valiani

1 Кафедра анатомии, Медицинская школа, Исфаханский университет медицинских наук , Иран

Моджтаба Эсмаэли

1 Кафедра анатомических наук, Медицинская школа, Исфаханский университет медицинских наук, Исфахан, Иран

Мохаммад Каземи

2 Факультет молекулярной биологии, Медицинская школа Исфаханского университета , Исфахан, Иран

Марьям Алиакбари

1 Кафедра анатомических наук, Медицинская школа, Исфаханский университет медицинских наук, Исфахан, Иран

Фархад Гольшан Иранпур

1 Кафедра анатомических наук, Медицинская школа Исфахана медицинских наук, Исфахан, Иран

1 Кафедра анатомических наук, Медицинский факультет, Исфаханский университет медицинских наук, Исфахан, Иран

2 Кафедра молекулярной биологии, Медицинский факультет, Исфаханский университет медицинских наук, Исфахан, Иран

* Автор, ответственный за переписку: Фархад Гольшан Иранпур.Кафедра анатомических наук, Медицинская школа, Исфаханский университет медицинских наук, Исфахан, Иран. Тел.: +98-31 37922426; Электронная почта: [email protected]

Поступила в редакцию 3 июля 2017 г.; Принято 28 сентября 2017 г.

Авторские права: © Iran Journal of Basic Medical Sciences

Это статья с открытым доступом, распространяемая в соответствии с условиями Creative Commons Attribution-Noncommercial-Share Alike 3.0 Unported, что разрешает неограниченное использование, распространение и воспроизведение в на любом носителе, при условии, что оригинальная работа правильно процитирована.

Эта статья была процитирована другими статьями в PMC.

Abstract

Цель(и):

Целью данного исследования было сравнение хондрогенного индукционного потенциала пиаскледина и TGF-β1 на стволовых клетках жировой ткани (ADSCs) в фибриновых и фибрин-альгинатных каркасах.

Материалы и методы:

Подкожная жировая ткань человека была взята у трех пациентов, которым была назначена липосакция. Изолированные ADSC пролиферировали в культуральной среде.Затем клетки высевали на фибриновые или фибрин-альгинатные каркасы и культивировали в течение 14 дней в хондрогенной среде, содержащей пиаскледин, ТФР-β1 или и то, и другое. Скорость пролиферации и выживаемости клеток оценивали с использованием МТТ [3-(4,5-диметилтиазолил-2)-2,5-дифенилтетразолия бромид] и скорости экспрессии коллагена II типа, аггрекана и коллагена X типа. генов оценивали методом полимеразной цепной реакции в реальном времени (ПЦР в реальном времени).

Результаты:

Результаты МТТ показали, что пиаскледин способен повышать пролиферацию и выживаемость ADSC в фибриновых каркасах по сравнению с другими группами ( P <0.05). Оценка ПЦР в реальном времени показала, что экспрессия коллагена II типа была выше в группах TGF-β1, но экспрессия аггрекана была выше в группе TGF-β1 отдельно или вместе с пиаскледином в фибрин-альгинатных каркасах. Кроме того, экспрессия коллагена типа X была ниже в пиаскледине отдельно или вместе с TGF-β1 в фибриновом каркасе.

Заключение:

Пиаскледин может усиливать пролиферацию и дифференцировку ADSC в фибриновых каркасах.

Ключевые слова: Хондрогенез, Пиаскледин, Стволовые клетки, Тканевая инженерия, Трансформирующий фактор роста бета 1

Введение

Суставной хрящ представляет собой особую соединительную ткань, состоящую из хондроцитов и их внеклеточного матрикса.Он может быть поврежден в результате травмы или естественного износа. Поскольку суставной хрящ лишен кровеносных сосудов, поврежденный хрящ заживает гораздо дольше (1, 2). Как быстро развивающаяся область, тканевая инженерия может предоставить альтернативные решения для восстановления суставного хряща. Тканевая инженерия использует комбинацию клеток и подходящих биохимических веществ для подготовки подходящих хрящевых тканей для лечения травм суставов (3).

В тканевой инженерии часто используются различные источники стволовых клеток, включая стволовые клетки костного мозга (BM-MSC) и стволовые клетки жировой ткани (ADSC).BM-MSC долгое время считались основным клеточным источником тканевой инженерии, но в последнее время ADSC привлекли большое внимание из-за их доступности, менее инвазивной природы и высокого хондрогенного потенциала (4).

Помимо использования различных типов стволовых клеток, в тканевой инженерии также используются различные факторы роста. Факторы роста играют ключевую роль в пролиферации, апоптозе и дифференцировке стволовых клеток. Семейство TGF-β (трансформирующий фактор роста-β) широко используется в инженерии хрящевой ткани.TGF-β индуцируют экспрессию некоторых генов, таких как коллаген II, гликан, а также способствуют построению гликозаминогликанов (5). Хотя TGF-β оказывают индуцирующее влияние на хондрогенез BM-MSC и ADSC, они имеют некоторые ограничения, которые необходимо учитывать при их использовании. Их высокая цена и короткий период полувыведения (от 24 до 72 часов) являются двумя их недостатками. Кроме того, эти факторы роста способствуют гипертрофии хондроцитов (6, 7). Пиаскледин — это растительная добавка, содержащая экстракты авокадо и сои в соотношении 1 к 2.Он используется для облегчения боли и отека, вызванных заболеваниями суставов, особенно остеоартритом (8).

Пиаскледин оказывает ингибирующее действие на коллагеназу II типа и простагландины и стимулирует синтез протеогликанов и коллагена. Он также снижает синтез фибронектина, что естественным образом приводит к восстановлению строения хряща. Кроме того, пиаскледин ингибирует IL-1β и оказывает стимулирующее действие на синтез коллагена II в хондроцитах (9) и на TGF-β1 (10).Следовательно, кажется, что использование пиаскледина отдельно или в сочетании с TGF-β1 может способствовать дифференцировке стволовых клеток в культуральной среде.

Биологические материалы играют решающую роль в тканевой инженерии. В связи с этим для восстановления тканей использовались различные природные и синтетические каркасы (11). Полезный каркас должен быть биоразлагаемым, биосовместимым и пористым. Кроме того, он должен обеспечивать подходящие условия для адгезии, пролиферации и миграции хондрогенных клеток (12, 13).Фибриновый каркас представляет собой сеть белков, которая удерживает вместе различные живые ткани. Фибрин обладает уникальными свойствами биосовместимости и вязкоупругости, но его устойчивость слаба и быстро разрушается (14). Фибриновый каркас облегчает пролиферацию и миграцию клеток, перенос молекул и пищи, а также удаление метаболитов (15). Несколько исследований предполагают, что фибриновые каркасы поддерживают пролиферацию и выживание BM-MSC (8). Комбинация фибрина и альгината повышает устойчивость полученного каркаса.Альгинат обычно извлекают из бурых водорослей, а его форма гидрогеля представляет собой пористый каркас. Альгинат способствует диффузии макромолекул, но в то же время является слабым и хрупким с точки зрения эластичности. Поэтому сочетание альгината с фибрином повышает его эластичность (14, 16-18).

Некоторыми из основных нерешенных проблем в процессе хондрогенеза являются неблагоприятные эффекты TGF-β и слабость каркасов. Цель настоящего исследования состояла в том, чтобы сравнить эффективность пиаскледина, TGF-β1 и их комбинации в отношении хондрогенной дифференцировки стволовых клеток, полученных из жировой ткани человека, в фибриновых и фибринальгинатных каркасах.

Материалы и методы

Химические вещества

Все химические вещества поставлялись компанией Sigma-Aldrich (Сент-Луис, Миссури, США), если не указано иное.

Схема эксперимента

После выделения ADSC из подкожной жировой ткани и трех пассажей клетки высевали на фибриновые или фибрин-альгинатные каркасы. Каждая из групп фибрина и фибринальгината была разделена на три подгруппы: TGFβ1 (10 нг/мл TGFβ1+ хондрогенная среда), пиаскледин (10 мкг/мл пиаскледин + хондрогенная среда) и TGF β1+ пиаскледин (10 нг/мл TGFβ1+10 мкг /мл Пиаскледин + хондрогенная среда).Готовили по три экземпляра каждой подгруппы и культивировали в течение 14 дней. На 14-й день клетки выделяли из фибриновых и фибринальгинатных каркасов. Пролиферацию клеток оценивали с помощью МТТ-анализа, а экспрессию генов, специфичных для хряща, оценивали с помощью ПЦР в реальном времени.

Выделение и культивирование ADSC человека

Образцы подкожно-абдоминальной жировой ткани были взяты у трех человек в возрасте 25–40 лет, которым была проведена плановая липосакция. Субъекты предоставили информированное согласие, и исследование было одобрено Институциональным комитетом по этике Исфаханского университета медицинских наук.Жировую ткань расщепляли раствором коллагеназы типа IA при 37°С в течение 30 мин. После этого к клеточной суспензии добавляли полную среду для культивирования клеток [среда DMEM с добавлением 10% эмбриональной бычьей сыворотки (FBS) и 1% пенициллина/стрептомицина (Gibco)] для нейтрализации активности фермента. Затем суспензию клеток центрифугировали при 1400 об/мин в течение 7 мин и удаляли супернатант вместе с адипоцитами. Наконец, полученный клеточный осадок культивировали в полной среде для культивирования клеток при 37°C, 5% CO 2 условиях (5).Дополнительные клетки удаляли путем замены среды через 24 часа ().

Инвертированные микроскопические изображения монослойной культуры ADSCs на третьем пассаже (40-кратное увеличение) (а) на 2-й день (б) на 6-й день соя) раствор

Пиаскледин был приобретен в Expanscience Laboratories (Франция). 0,1 мг пиаскледина растворяли в 10 мл чистого этанола до конечной концентрации 10 мкг/мл.

Препарат тромбина, фибриногена и альгината

Свежезамороженная плазма (СЗП) использовалась для приготовления тромбина. Пакет СЗП был получен из Банка крови провинции Исфахан (Исфахан, Иран), и его содержимое расплавили на водяной бане при 37°С в течение 10 мин. 16 мл СЗП и 10 мл глюконата кальция переносили в стерильную пробирку и затем инкубировали при 37 °С в течение 60–90 мин. После инкубации пробирки центрифугировали при 2200 об/мин в течение 10 мин. Прозрачный супернатант из каждой пробирки, содержащий тромбин, разделяли на аликвоты в пробирки объемом 1 мл и хранили при -80 °C (19).Для приготовления фибриногена использовали криопреципитат. Криопреципитат является удовлетворительным источником фибриногена.

Пакет с криопреципитатом был получен из Банка крови провинции Исфахан и помещен в водяную баню при 37 °C на 10 мин. Затем наружную поверхность мешка дезинфицировали 70%-ным спиртом и удаляли его содержимое с помощью шприца на 10 мл в стерильных условиях (19).

Для приготовления альгината 0,15 г порошка альгината растворяли в 10 мл 0,9% хлорида натрия и полученный раствор стерилизовали фильтрованием через фильтр 0.Фильтр 2 мкм (20).

Перенос клеток на фибриновые и фибринальгинатные каркасы

В каждую лунку 24-луночного клеточного планшета добавляли по 300 мкл криопреципитата, содержащего большое количество фибриногена. В каждую лунку добавляли по 30 мкл суспензии ADSC, содержащей один миллион клеток.

Затем добавляли 300 мкл тромбина и планшет оставляли на 10 мин для формирования фибринового каркаса (19).

После отделения третьего пассажа культивируемых клеток ADSC клетки подсчитывали.На каждый миллион клеток добавляли 1 мл 1,5% альгината. Затем клеточно-альгинатную суспензию медленно добавляли к 10 2 мМ раствора хлорида кальция (Merck), пропуская через шприц 23 калибра в 24-луночный планшет. После выдерживания раствора в течение 15 мин при комнатной температуре образовывались шарики альгината; затем удаляли хлорид кальция и трижды промывали шарики 0,9% раствором хлорида натрия (20). После этого в каждую лунку добавляли по 300 мкл фибриногена и тромбина и через несколько минут образовывался фибриновый сгусток, содержащий альгинат ().

Фотографии хондроцитов, посеянных на фибриновые (а) и фибрин-альгинатные (б) каркасы

ADSC были посеяны на фибриновые или фибрин-альгинатные каркасы и культивированы в среде для хондрогенной дифференцировки [DMEM с высоким содержанием глюкозы (Gibco), 1% пенициллина и стрептомицина ( Gibco), 10 -8 моль Дексаметазон (Sigma), 1% ITS (инсулин, трансферрин, селен) (Sigma), 1% BSA (бычий сывороточный альбумин) (Sigma), 50 мкг/мл ASP (аскорбат-2-фосфат) (Sigma), 5 мкг/мл линолевой кислоты (Sigma)] с добавлением TGFβ1 (10 нг/мл), пиаскледина (10 мкг/мл) или их комбинации (10 нг/мл TGFβ1 и 10 мкг/мл пиаскледина)].

3-(4,5-диметилтиазолил-2)-2,5-дифенилтетразолия бромид (МТТ) Анализ

Тесты на жизнеспособность проводились с использованием колориметрического анализа МТТ. На 14-й день среду удаляли и заменяли 400 мкл DMEM с высоким содержанием глюкозы и 40 мкл раствора МТТ (5 мг/мл в PBS). Затем инкубировали при 37°C, 5% CO 2 в течение 4 часов. Затем среду удаляли, в каждую лунку добавляли 400 мкл диметилсульфоксида (ДМСО) и инкубировали в течение 2 ч в темноте при комнатной температуре. ДМСО растворял кристаллы формазана и окрашивал их в пурпурный цвет.Наконец, 100 мкл каждой лунки переносили в 96-луночные планшеты и измеряли величину светопоглощения или оптическую плотность (OD) при длине волны 570 нм с помощью считывателя ELISA (Hyperion MPR4). Все измерения были выполнены в трех повторностях (21, 22).

Анализ полимеразной цепной реакции в реальном времени (ПЦР в реальном времени)

ПЦР в реальном времени использовали для оценки экспрессии генов особых молекул хрящевого матрикса. На 14-й день фибриновые и фибрин-альгинатные матриксы промывали PBS.Для фибринового каркаса к клеточной массе добавляли 990 мкл тризола с 10 мкл меркаптоэтанола и помещали клеточный планшет на 5 мин при комнатной температуре. После этого к раствору добавляли 200 мкл хлороформа и после 15 с энергичного встряхивания планшет помещали на 2–3 мин при комнатной температуре. Затем раствор центрифугировали при 12000 об/мин, 4°С в течение 15 мин. Для фибрин-альгинатного каркаса 5,1 мМ 15% цитрата натрия (Sharlau) добавляли к 0,15 мМ хлорида натрия (Merck) и раствор центрифугировали при 1200 об/мин в течение 10 минут для расщепления альгинатных шариков.Мини-набор RNeasy (Qiagen, каталожный номер 74101) использовали для выделения РНК из полученных клеток. Синтез кДНК осуществляли с использованием олиго-праймеров и набора для синтеза кДНК первой цепи revertaid (Fermentas, Англия). ПЦР в реальном времени проводили на термоциклере Rotor-Gene 6000 Real-time (Corbett Research Pty. Ltd., Австралия). Смесь для ПЦР содержала 10 мкл экстрагированной РНК и 1 мкл олигонуклеотида, ингибитора рибонуклеазы, дезоксинуклеозидтрифосфата (дНТФ) и фермента реверстанскриптазы.Затем последовательно добавляли следующие компоненты: 2,5 мкл 10-кратного буфера, 0,5 мкл 10 мМ dNTP, 1 мкл праймера F, 1 мкл праймера R, 2 мкл приготовленной ДНК Taq, 0,5 мкл полимеразного фермента и H 2 O. до достижения конечного объема 25 мкл. Затем кДНК амплифицировали при следующих условиях:

Денатурация при 95 °С в течение 10 минут, денатурация при 95 °С в течение 15 секунд, отжиг при 60 °С в течение одной минуты и удлинение при 72 °С в течение одной минуты, весь процесс проводили в течение 40 циклов (23-25).В конце концов, кривая плавления была построена с помощью программного обеспечения для кривой плавления. Этот протокол использовали для всех трех генов. Все праймеры, использованные в ПЦР в реальном времени, были разработаны с помощью программного обеспечения Allele ID (версия 7.6) в соответствии с .

Таблица 1

Таблица 1

Гены и праймеры, используемые в реальной реакции цепной реакции в реальном времени

Scale Scale
CL II-F CTGGTGATGATGHTGAGTGAAG 0.02 мкмоль
Col II-F CCTGGATAACCTCTGTGA
Агра-F GTGGGACTGAAGTTCTTG 0,02 мкмоль
Агра-R GTTGTCATGGTCTGAAGTT
GAPDH-F AAGTCATTTCCTGGTATG 0,02 мкмоль
GAPDH-R CTTCCTCTTGTGCTCTTG
Col XF AGAATCCATCTGAGAATATGC 0,02 мкмоль
Col XR AGAATCCATCTGAGAATATGC

Статистический анализ

Все статистические анализы были выполняется с использованием программного обеспечения SPSS для Windows (Statistical Package for the Social Sciences, версия 19, SPSS Inc., Чикаго, Иллинойс, США). Данные выражали как среднее значение ± стандартная ошибка среднего. Критерий Колмогорова-Смирнова использовался для проверки нормальности распределения данных.

Данные были проанализированы с использованием однофакторного ANOVA и LSD апостериорных тестов . Значения с P <0,05 считались статистически значимыми.

Результаты

Анализ 3-(4,5-диметилтиазолил-2)-2,5-дифенилтетразолия бромида (МТТ)

Результаты нашего анализа МТТ обобщены в . Эти результаты показали, что пиаскледин может значительно увеличить пролиферацию и выживаемость ADSC-дифференцированных клеток в фибриновом каркасе по сравнению с контрольными группами, TGF-β1 отдельно в фибрине и TGF-β1 вместе с пиаскледином в фибриновых группах.

Результаты анализа МТТ через 14 дней после культивирования ADSC в хондрогенной среде с добавлением TGF-β1, пиаскледина или того и другого в фибриновых или фибрин-альгинатных каркасах. Звездочки указывают на существенные различия между группами. * P <0,05, ** P <0,01, *** P <0,001

фибрин-альгинатный каркас ( P =0.045), а также только пиаскледин в фибрин-альгинатном каркасе ( P = 0,045).

ПЦР в реальном времени

Результаты ПЦР в реальном времени показали значительные различия в экспрессии генов коллагена II, X и аггрекана в разных группах ( P <0,01). На 14-й день экспрессия гена коллагена II типа была значительно выше в группах TGF-β1 (фибриновые или фибрин-альгинатные каркасы) по сравнению с группами пиаскледина (фибриновые или фибрин-альгинатные каркасы) ( P <0.05). Хотя экспрессия генов коллагена II типа и аггрекана не показала значительного увеличения на 14-й день, пиаскледин мог индуцировать хондрогенез сам по себе. Наибольшая экспрессия аггрекана была в ТФР-β1 отдельно или вместе с пиаскледином в группах фибрин-альгинатных каркасов. Самая высокая экспрессия гена коллагена типа X была в TGF-β1 в группе фибрин-альгинатного каркаса ( P <0,001). Кроме того, экспрессия гена коллагена типа X ниже при монотерапии пиаскледином в фибрине и TGF-β1 отдельно или вместе с пиаскледином в группах фибринового каркаса (1).

Результаты экспрессии генов коллагена II (а), коллагена Χ (б) и аггрекана в различных группах через 14 дней после культивирования стволовых клеток жировой ткани. Данные представлены как среднее значение ± стандартное отклонение. Столбики погрешностей представляют собой стандартное отклонение среднего значения. Звездочки указывают на существенные различия между группами. NS: Незначительно, * P <0,05, ** P <0,01, *** P <0,001. Относительное количество (RQ) указывает на относительный уровень экспрессии генов

Обсуждение

TGFβ1 является белком-членом полипептида, который выполняет множество клеточных функций, таких как пролиферация и дифференцировка клеток.Он способен стимулировать хондроциты к синтезу коллагена II типа и протеогликанов. Он также используется для индукции хондрогенной дифференцировки различных мезенхимальных стволовых клеток (26). Из-за некоторых неблагоприятных эффектов TGF-β, таких как гипертрофия дифференцированных хондроцитов из ADSC, рассматриваются другие альтернативы.

Пиаскледин (неомыляемые вещества авокадо/сои) представляет собой натуральный растительный экстракт, состоящий на одну треть из авокадо и на две трети из соевых неомыляемых веществ.На клиническом уровне пиаскледин уменьшает боль и тугоподвижность суставов, что приводит к снижению зависимости от анальгетиков (27). Уже сообщалось, что присутствие пиаскледина в культуральной среде в течение 21 дня может индуцировать хондрогенез ADSCs в фибриновых или фибрин-альгинатных каркасах (28, 29). В настоящем исследовании потенциал хондрогенной индукции пиаскледина и TGFβ1 одновременно сравнивали на 14-й день после культивирования ADSC в фибриновых или фибрин-альгинатных каркасах.

Результаты нашего анализа МТТ показали, что пиаскледин в присутствии способен повышать пролиферацию и выживаемость дифференцирующихся хондроцитов в фибриновых каркасах и более эффективен, чем TGFβ1.В соответствии с нашими результатами некоторые исследователи сообщили, что пиаскледин обладает хондропротекторными, анаболическими и антикатаболическими свойствами. Кроме того, он подавляет разрушение хряща и способствует его восстановлению (8, 9, 30, 31). Кроме того, пиаскледин изменяет уровни фактора роста, участвующего в патогенезе остеоартрита, повышая TGF-β1 и TGF-β2 в жидкости коленного сустава собак (32) и уменьшая опосредованную воспалением деградацию хряща за счет снижения продукции IL-1, PGE2 и MMP-3 в суставах собак. культивированные суставные хондроциты (33).

Было показано, что пиаскледин стимулирует синтез коллагена и протеогликанов в культивируемых хондроцитах (34). Исследование in vitro показало, что пиаскледин может стимулировать выработку аггрекана и восстанавливать выработку аггрекана после лечения IL-1 бета (31). В этом исследовании анализ результатов ПЦР в реальном времени на 14 -й день после культивирования ADSCs показал, что экспрессия коллагена II типа выше в группах TGF-β1. Экспрессия гена аггрекана была выше в монотерапии TGF-β1 или вместе с пиаскледином в фибрин-альгинатных каркасах.Кроме того, экспрессия гена коллагена типа X была ниже в пиаскледине отдельно или вместе с TGF-β1 в фибриновых каркасах. Следует отметить, что для индукции хондрогенеза в стволовых клетках и получения гиалинового хряща необходимо снизить экспрессию гена коллагена X, чтобы предотвратить гипертрофию сконструированного хряща. За исключением результатов для гена коллагена типа X, полученные результаты, относящиеся к коллагену типа II и аггрекану, противоречат предыдущим сообщениям на 21 -й день после культивирования дифференцирующихся ADSC.Согласно этим предыдущим результатам, пиаскледин может значительно увеличить экспрессию генов коллагена II типа и аггрекана по сравнению с TGFβ1 во время индукции хондрогенеза в ADSC (28, 29). Похоже, что 14 дней культивирования недостаточно для обнаружения высокого уровня экспрессии генов коллагена и аггрекана типа II в дифференцированных ADSC, и экспрессия этих генов повысится через 21 день после культивирования ADSC.

Использование соответствующих каркасов является одной из основных проблем тканевой инженерии.Эти каркасы должны быть очень похожи на внеклеточный матрикс суставного хряща (5, 35).

Кроме того, механическая стабильность и неактивность каркаса играют важную роль в сохранении клеток и биоматериалов. Эти биоматериалы необходимы для клеточной адгезии, пролиферации и дифференцировки в поврежденных тканях (36-38). В тканевой инженерии биоматериалы специфичны для каждой ткани, и в большинстве случаев используются гидрогели, такие как фибрин, который состоит из внеклеточных белков матрикса (38).Фибриновый каркас имеет равномерное распределение клеток и может легко вмещать биомолекулы (15).

Этот каркас является биологически разлагаемым и может без труда использоваться для восстановления различных поврежденных тканей (39). Драгу и др. . показали, что фибрин является наиболее подходящим каркасом для восстановления суставного хряща кролика (40). Исследование показало, что смешивание хондроитинсульфата с фибрином увеличивает экспрессию генов коллагена II и GAG (группоспецифического антигена) по сравнению с одним фибрином (41).Также Жирандон и др. . показали, что ADSC способны воспроизводиться и выживать в фибриновом каркасе (42). Примечательно, что в отличие от предыдущих исследований, в которых использовался коммерческий фибрин, человеческий исходный фибрин изготавливался вручную и использовался в этом исследовании. Хотя фибрин обладает уникальными вязкоупругими свойствами, он слаб с точки зрения устойчивости, а также быстро разлагается.

Смешивание фибрина с альгинатом может повысить устойчивость каркаса (15, 43). Альгинат получают из бурых водорослей или полисахаридной капсулы бактерий.Натуральный полисахарид альгинат легко превращается в гель без необходимости использования органических растворителей или изменения рН и температуры. Хотя альгинат является пористым в гелеобразном состоянии и это свойство облегчает диффузию в него макромолекул, он является слабым и хрупким с точки зрения эластичности. Сочетание альгината и фибрина повышает его эластичность как каркаса. Фактически, смесь фибрина и альгината обеспечивает баланс между деградацией и эластичностью и может создать подходящий внеклеточный матрикс для роста клеток.(44-46). Ма и др. . использовали комбинацию фибрина и альгината в качестве каркаса для индукции хондрогенеза в СККМ и показали, что фибрин повышает эластичность каркаса, а также увеличивает пролиферацию клеток. Кроме того, альгинат увеличивает экспрессию генов, специфичных для хряща, и продукцию внеклеточного матрикса (47). Наши результаты показывают, что пиаскледин может значительно поддерживать выживание дифференцирующихся ADSC в фибриновых каркасах лучше, чем любые другие группы. Кроме того, использование пиаскледина отдельно или вместе с TGF-β1 снижает экспрессию коллагена типа X в фибриновых каркасах.Результаты показывают, что фибриновые каркасы обеспечивают лучшие результаты, чем фибрин-альгинатные каркасы.

Заключение

Пиаскледин может улучшать пролиферацию и выживаемость ADSC, дифференцирующихся в хондроциты в фибриновых каркасах. Хотя в предыдущих сообщениях было показано, что пиаскледин может увеличивать экспрессию коллагена типа II и аггрекана после 21-дневного культивирования дифференцирующихся ADSC, 14-дневного культивирования недостаточно для обнаружения высокой экспрессии этих генов. Кроме того, использование пиаскледина снижает экспрессию маркера гипертрофии, коллагена типа X, в фибриновых каркасах.

Благодарность

Результаты, представленные в этой статье, были извлечены из двух магистерских диссертаций (393722 и 394263). Авторы благодарят за поддержку Исфаханский университет медицинских наук, Исфахан, Иран.

Конфликт интересов

В данном исследовании отсутствует конфликт интересов.

Ссылки

2. Mitchell N, Shepard N. Восстановление поверхности суставного хряща взрослого кролика путем множественных перфораций через субхондральную кость.J Bone Joint Surg Am. 1976; 58: 230–233. [PubMed] [Google Scholar]3. Мардани М., Хашемибени Б., Ансар М.М., Эсфахани С.Х., Каземи М., Гохарян В. и др. Сравнение хондрогенных маркеров дифференцированных хондроцитов из стволовых клеток жировой ткани и суставных хондроцитов in vitro . Иран J Basic Med Sci. 2013; 16: 763–773. [Бесплатная статья PMC] [PubMed] [Google Scholar]4. Colter DC, Sekiya I, Prockop DJ. Идентификация субпопуляции быстро самообновляющихся и мультипотенциальных взрослых стволовых клеток в колониях стромальных клеток костного мозга человека.Proc Natl Acad Sci USA. 2001; 98:7841–7845. [Бесплатная статья PMC] [PubMed] [Google Scholar]5. Хахемибени Б., Разави Ш., Эсфандиари Э., Карбаси С., Мардани М., Насресфахани М. Индукция хондрогенной дифференцировки стволовых клеток, полученных из жировой ткани человека, с помощью TGF-β3 в системе культивирования гранул. Иран J Basic Med Sci. 2008; 11:10–17. [Google Академия]6. Giovannini S, Diaz-Romero J, Aigner T, Heini P, Mainil-Varlet P, Nesic D. Совместное культивирование микромасс суставных хондроцитов человека и мезенхимальных стволовых клеток костного мозга человека для исследования образования стабильной ткани неохряща in vitro .Eur Cell Mater. 2010;20:59. [PubMed] [Google Scholar]8. Henrotin YE, Labasse AH, Jaspar JM, De Groote DD, Zheng SX, Guillou GB, et al. Влияние трех неомыляемых смесей авокадо/сои на выработку металлопротеиназ, цитокинов и простагландина E 2 суставными хондроцитами человека. Клин Реум. 1998; 17:31–39. [PubMed] [Google Scholar]9. Мовьель А., Дайро М., Хартманн Д.Дж., Галера П., Лойо Г., Пужоль Дж.П. Влияние неомыляемых экстрактов авокадо/соевых бобов (PIAS) на выработку коллагена культурами синовиоцитов, суставных хондроцитов и фибробластов кожи.Рев Рум Мал Остеоартик. 1989; 56:207. [На французском] [PubMed] [Google Scholar]10. Хантер Диджей. Фармакотерапия остеоартрита — эпоха модификации болезни. Nat Rev Rheumatol2010; 7:13–22. [PubMed] [Google Scholar] 11. Брин А., Докери П., О’Брайен Т., Пандит А. Каркас из фибрина способствует переносу аденовирусного гена и контролируемой доставке вектора. J Biomed Mater Res A. 2009; 89: 876–884. [PubMed] [Google Scholar] 12. Чен Г., Ушида Т., Татейши Т. Биоразлагаемая гибридная губка, вложенная в коллагеновые микрогубки.J Biomed Mater Res. 2000; 51: 273–279. [PubMed] [Google Scholar] 13. Лахиджи А., Сохраби А., Хангерфорд Д.С., Фрондоза К.Г. Хитозан поддерживает экспрессию белков внеклеточного матрикса в остеобластах и ​​хондроцитах человека. J Biomed Mater Res. 2000; 51: 586–595. [PubMed] [Google Scholar] 14. Чжоу Х, Сюй ХХ. Быстрое высвобождение стволовых клеток из альгинатно-фибриновых микрогранул в инъекционных каркасах для инженерии костной ткани. Биоматериалы. 2011;32:7503–7513. [Бесплатная статья PMC] [PubMed] [Google Scholar]15. Buser Z, Liu J, Thorne KJ, Coughlin D, Lotz JC.Воспалительная реакция клеток межпозвонкового диска уменьшается с помощью каркаса из фибринового герметика in vitro. J Tissue Eng Regen Med. 2014; 8:77–84. [PubMed] [Google Scholar] 16. Шиканов А., Сюй М., Вудрафф Т.К., Ши Л.Д. Взаимопроникающие фибрин-альгинатные матрицы для in vitro развития фолликулов яичников. Биоматериалы. 2009; 30: 5476–5485. [Бесплатная статья PMC] [PubMed] [Google Scholar]17. Моррис В.Дж. Гелеобразование полисахаридов. В: Митчелл Дж. Р., Ледвард Д. А., редакторы. Функциональные свойства пищевых макромолекул.Нью-Йорк: Эльзевир; 1986. С. 121–128. [Google Академия] 18. Хашемибени Б., Разави С., Эсфандиари Э., Карбаси С., Мардани М., Садеги Ф. и др. Влияние трансформирующего фактора роста-β3 и факторов роста костного морфогенетического белка-6 на хондрогенную дифференцировку стволовых клеток жирового происхождения в альгинатном каркасе. J Isfahan Med Sch. 2010:28. [На персидском] [Google Scholar] 19. Ян Ш., Ву К.С., Ши Т.Т., Чен П.К., Линь Ф.Х. Трехмерная культура клеток студенистого ядра человека в фибриновом сгустке: сравнение клеточной пролиферации и синтеза матрикса с клетками в альгинате.Артиф Органы. 2008; 32:70–73. [PubMed] [Google Scholar] 20. Валиани А., Хашемибени Б., Эсфандиари Э., Ансар М.М., Каземи М., Эсмаили Н. Изучение влияния углеродных нанотрубок на хондрогенез стволовых клеток, полученных из жировой ткани человека, в альгинатном каркасе. Int J Prev Med. 2014;5:825–834. [Бесплатная статья PMC] [PubMed] [Google Scholar]21. Роули Дж.А., Мадламбаян Г., Муни Д.Дж. Альгинатные гидрогели как материалы синтетического внеклеточного матрикса. Биоматериалы. 1999; 20:45–53. [PubMed] [Google Scholar] 22. Ван Зи, Чжан Ку Зи, Конно М, Сайто С.Золь-гель переход раствора альгината при добавлении различных двухвалентных катионов: 13С-ЯМР спектроскопическое исследование. Биополимеры. 1993; 33: 703–711. [Google Академия] 23. Эсфандиари Э., Валиани А., Хашемибени Б., Моради И., Наримани М. Оценка токсичности углеродных нанотрубок на стволовых клетках человека, полученных из жировой ткани in-vitro . Adv Biomed Res. 2014;3:40. [Бесплатная статья PMC] [PubMed] [Google Scholar]24. Ян Дж., Донг Л., Чжан Б., Ци Н. Влияние крайне низкочастотного магнитного поля на рост и дифференцировку мезенхимальных стволовых клеток человека.Электромагн Био Мед. 2010;29:165–176. [PubMed] [Google Scholar] 25. Creecy CM, O’Neill CF, Arulanandam BP, Sylvia VL, Navara CS, Bizios R. Остеодифференцировка мезенхимальных стволовых клеток в ответ на переменный электрический ток. Tiss Eng Часть A. 2012; 19: 467–474. [Бесплатная статья PMC] [PubMed] [Google Scholar]26. Grimaud E, Heymann D, Rédini F. Недавние достижения в области влияния TGF-β на метаболизм хондроцитов: потенциальная терапевтическая роль TGF-β при заболеваниях хряща. Обзоры цитокинов и факторов роста. 2002; 13: 241–257.[PubMed] [Google Scholar] 27. Кристиансен Б.А., Бхатти С., Гударзи Р., Эмами С. Лечение остеоартрита неомыляемыми соединениями авокадо/сои. Хрящ. 2015;6:30–44. [Бесплатная статья PMC] [PubMed] [Google Scholar]28. Didehvar H, Golshan-Iranpour F, Valiani A, Hashemibeni B, Esmaeeli M. Сравнение эффектов трансформирующего фактора роста бета1 (TGF-ß1) и пиаскледина на экспрессию генов коллагена II, X и аггрекана в хондрогенезе жировой ткани человека. стволовые клетки в композитном каркасе из фибрин-альгината.J Isfahan Med Sch. 2016; 34: 157–165. [На персидском] [Google Scholar] 29. Эсмаили М., Хашемибени Б., Валиани А., Амирпур Н., Пурмоллааббаси Б., Каземи М. Влияние пиасклидина на индукцию хондрогенеза стволовыми клетками, полученными из жировой ткани человека, в фибриновом каркасе. J Isfahan Med Sch. 2016; 33: 1862–1870. [На персидском] [Google Scholar]30. Lamaud E, Robert AM, Wepierre J. Биохимические эффекты неомыляемых липидных компонентов авокадо и соевых бобов, вводимых чрескожно, на компоненты соединительной ткани безволосой кожи крысы.Int J Cosmet Sci. 1979; 1: 213–219. [PubMed] [Google Scholar] 31. Henrotin YE, Sanchez C, Deberg MA, Piccardi N, Guillou GB, Msika P, et al. Неомыляемые соединения авокадо/сои увеличивают синтез аггрекана и снижают выработку катаболических и провоспалительных медиаторов остеоартритными хондроцитами человека. J Ревматол. 2003; 30: 1825–1834. [PubMed] [Google Scholar] 32. Алтинел Л., Саритас З.К., Козе К.С., Памук К., Аксой Ю., Сертесер М. Лечение неомыляемыми экстрактами авокадо и сои повышает уровни ТФР-бета1 и ТФР-бета2 в суставной жидкости собак.Тохоку J Exp Med. 2007; 211:181–186. [PubMed] [Google Scholar] 33. Lippiello L, Nardo JV, Harlan R, Chiou T. Метаболические эффекты неомыляемых соединений авокадо/сои на суставные хондроциты. Комплемент на основе Evid Alternat Med. 2008; 5: 191–197. [Бесплатная статья PMC] [PubMed] [Google Scholar]34. Кухарз Э.Дж. Применение неомыляемых смесей авокадо/сои (пиаскледин) в лечении больных остеоартрозом. Ортоп Травматол Реабилит. 2003; 5: 248–251. [PubMed] [Google Scholar] 35. Хунцикер ЭБ. Индуцированное фактором роста заживление дефектов частичной толщины во взрослом суставном хряще.Хрящевой остеоартрит. 2001; 9: 22–32. [PubMed] [Google Scholar] 36. Джордж М., Авраам Т.Е. Полиионные гидроколлоиды для кишечной доставки белковых препаратов: альгинат и хитозан – обзор. J Управление выпуском. 2006; 114:1–14. [PubMed] [Google Scholar] 37. Раби А., Эсфандиари Э., Фешараки М., Санайе М., Аминмансур Б., Хашемибени Б. Доступ к трехмерной культуре остеобластов, происходящих из черепа человека в Иране. J Isfahan Med Sch. 2010; 27: 777–787. [На персидском] [Google Scholar] 38. Харрисон П., Уилборн Б., Дебили Н., Вайнченкер В., Бретон-Гориус Дж., Лори А.С. и др.Поглощение фибриногена плазмы альфа-гранулами мегакариоцитов и тромбоцитов человека. Джей Клин Инвест. 1989; 84: 1320–1324. [Бесплатная статья PMC] [PubMed] [Google Scholar]39. Le Nihouannen D, Guehennec LL, Rouillon T, Pilet P, Bilban M, Layrolle P, et al. Микроструктура гранул фосфата кальция и композитов фибринового клея для инженерии костной ткани. Биоматериалы. 2006; 27: 2716–2722. [PubMed] [Google Scholar]40. Драгу Д.Л., Карлсон Г., Маккормик Ф., Хан-Фаруки Х., Чжу М., Зук П.А. и др. Заживление полнослойных дефектов хряща с использованием стволовых клеток, полученных из жировой ткани.Ткань англ. 2007; 13:1615–1621. [PubMed] [Google Scholar]41. Wei Y, Hu Y, Hao W, Han Y, Meng G, Zhang D и др. Новый инъекционный каркас для инженерии хрящевой ткани с использованием взрослых стволовых клеток, полученных из жировой ткани. J Ортоп Res. 2008; 26:27–33. [PubMed] [Google Scholar]42. Girandon L, Kregar-Velikonja N, Bozikov K, Barlic A. In vitro модели для инженерии жировой ткани с использованием стволовых клеток, полученных из жировой ткани, с использованием различных каркасов природного происхождения. Фолиа Биол. 2011;57:47–56. [PubMed] [Google Scholar]43.Чжао Л., Вейр М.Д., Сюй Х.Х. Инъекционная паста из мезенхимальных стволовых клеток пуповины, гидрогеля, фосфата кальция и альгината для инженерии костной ткани. Биоматериалы. 2010;31:6502–6510. [Бесплатная статья PMC] [PubMed] [Google Scholar]44. Chien CS, Ho HO, Liang YC, Ko PH, Sheu MT, Chen CH. Включение экссудата человеческого геля фибрина, богатого тромбоцитами, в биоразлагаемые фибриновые каркасы для тканевой инженерии хряща. J Biomed Mater Res B Appl Biomater. 2012; 100:948–955. [PubMed] [Google Scholar]45. Стивенс М.М., Канадило Х.Ф., Лангер Р., Прасад С.В.Система быстрого отверждения альгинатного геля: полезность в инженерии хрящевой ткани, полученной из надкостницы. Биоматериалы. 2004; 25:887–894. [PubMed] [Google Scholar]46. Стивенс М.М., Марини Р.П., Мартин И., Лангер Р., Прасад С.В. FGF-2 усиливает индуцированный TGF-бета1 периостальный хондрогенез. J Ортоп Res. 2004; 22:1114–1119. [PubMed] [Google Scholar]47. Ма Х.Л., Хун С.К., Лин С.И., Чен Ю.Л., Ло У.Х. Хондрогенез мезенхимальных стволовых клеток человека, инкапсулированных в альгинатные шарики. J Biomed Mater Res. 2003; 64: 273–281. [PubMed] [Google Scholar]

Обзор механизмов

[1] Краус В., Бланко Ф., Инглунд М. и др.(2015) Призыв к стандартизированным определениям остеоартрита и стратификации риска для клинических испытаний и клинического использования. Osteoarthr Cartil 23: 1233–1241. doi: 10.1016/j.joca.2015.03.036
[2] Pesesse L, Sanchez C, Delcour JP, et al. (2013) Последствия гипертрофии хондроцитов на остеоартритный хрящ: потенциальное влияние на ангиогенез. Osteoarthr Cartil 21: 1913–1923. doi: 10.1016/j.joca.2013.08.018
[3] Беренбаум Ф. (2013)Остеоартрит как воспалительное заболевание (остеоартрит – это не остеоартроз!). Osteoarthr Cartil 21: 16–21. doi: 10.1016/j.joca.2012.11.012
[4] Henrotin Y, Pesesse L, Lambert C (2014) Ориентация на синовиальный ангиогенез как новый подход к лечению остеоартрита. Ther Adv Musculoskeletal Dis 6: 20–34. дои: 10.1177/1759720X13514669
[5] Henrotin Y, Pesesse L, Sanchez C (2012)Субхондральная кость и остеоартрит: биологические и клеточные аспекты. Остеопороз Int 23: 47–51.
[6] Санчес С., Песес Л., Габай О. и др.(2012) Регуляция метаболизма остеобластов субхондральной кости путем циклического сжатия. Ревматоидный артрит 64: 1193–1203. дои: 10.1002/арт.33445
[7] Санчес С., Деберг М., Белласен А. и др. (2008) Фенотипическая характеристика остеобластов из склеротических зон остеоартритной субхондральной кости. Ревматоидный артрит 58: 442–455. дои: 10.1002/арт.23159
[8] Pesesse L, Sanchez C, Henrotin Y (2011)Ангиогенез костно-хрящевой пластины: новая цель лечения остеоартрита. Jt Bone Spine 78: 144–149. doi: 10.1016/j.jbspin.2010.07.001
[9] Рахмати М., Мобашери А. (2016) Мозафари М. . Медиаторы воспаления при остеоартрите: критический обзор современного состояния, текущих перспектив и будущих задач. Кость 85: 81–90.
[10] Бертулья А., Лакур М., Жирар С. и др. (2016) Остеокласты рекрутируются в субхондральную кость при естественном посттравматическом остеоартрите запястья у лошадей и могут способствовать деградации хряща. Костный хрящ 24: 555–566. doi: 10.1016/j.joca.2015.10.008
[11] Санчес С., Габай О., Сальват С. и др. (2009) Механическая нагрузка значительно увеличивает продукцию IL-6 и снижает экспрессию OPG остеобластами. Остеоартрит Хрящ 7: 473–481.
[12] Henrotin Y, Pesesse L, Sanchez C (2009)Субхондральная кость в физиопатологии остеоартрита: современное состояние и перспективы. Biomed Mater Eng 19: 311–316.
[13] Hügle T, Geurts J (2017) Что движет остеоартритом? Синовиальная или субхондральная костная патология. Rheumatology (Оксфорд) 56: 1461–1471.
[14] Веронезе Н., Тревизан С., Де Руи М. и др.(2015)Остеоартрит увеличивает риск сердечно-сосудистых заболеваний у пожилых людей: исследование progetto veneto anziano. Ревматоидный артрит 68: 1136–1144.
[15] Эймард Ф., Парсонс С., Эдвардс М.Х. и др. (2015) Диабет является фактором риска прогрессирования остеоартрита коленного сустава. Osteoarthr Cartilag e 23: 851–859.doi: 10.1016/j.joca.2015.01.013
[16] да Коста Б.Р., Райхенбах С., Келлер Н. и др. (2017)Эффективность нестероидных противовоспалительных препаратов для лечения боли при остеоартрите коленного и тазобедренного суставов: сетевой метаанализ. Ланцет 387: 2093–2105.
[17] Робертс Э., Дельгадо Нуньес В., Бакнер С. и др.(2016) Парацетамол: не так безопасен, как мы думали? Систематический обзор литературы по обсервационным исследованиям. Энн Реум Дис 75: 552–559.
[18] Павелка К., Косте П., Гехер П. и др. (2010)Эффективность и безопасность пиаскледина 300 по сравнению с хондроитинсульфатом при 6-месячном лечении плюс 2-месячное наблюдение у пациентов с остеоартритом коленного сустава. Clin Rheumatol 29: 659–670. doi: 10.1007/s10067-010-1384-8
[19] Аппельбум Т., Шуерманс Дж., Вербрюгген Г. и др. (2001) Симптомы, изменяющие эффект неомыляемых соединений авокадо/сои (ASU) при остеоартрите коленного сустава. Двойное слепое проспективное плацебо-контролируемое исследование. Acta Rheumatol Scand 30: 242–247.
[20] Маэ Э., Мазьер Б., Валат Дж. П. и др. (1998) Симптоматическая эффективность неомыляемых соединений авокадо/сои при лечении остеоартрита коленного и тазобедренного суставов: проспективное, рандомизированное, двойное слепое, плацебо-контролируемое, многоцентровое клиническое исследование с шестимесячным периодом лечения и двухмесячным последующим наблюдением. демонстрирует стойкий эффект. Ревматоидный артрит 41: 81–91. doi: 10.1002/1529-0131(199801)41:13.0.CO;2-9
[21] Блотман Ф., Маэ Э., Вулвик А. и др. (1997)Эффективность и безопасность неомыляемых соединений авокадо/сои при лечении симптоматического остеоартрита коленного и тазобедренного суставов. Проспективное многоцентровое трехмесячное рандомизированное двойное слепое плацебо-контролируемое исследование. Rev Rhum Engl Ed 64: 825–834.
[22] Кристенсен Р., Бартелс Э.М., Аструп А. и соавт. (2008) Симптоматическая эффективность неомыляемых соединений авокадо-сои (ASU) у пациентов с остеоартритом (ОА): метаанализ рандомизированных контролируемых исследований. Остеоартрит Хрящ 16: 399–408. doi: 10.1016/j.joca.2007.10.003
[23] Маэ Э., Кадет С., Марти М. и др.(2014) Рандомизированное контролируемое исследование влияния неомыляемых соединений авокадо-сои (пиаскледин) на структурную модификацию при остеоартрите тазобедренного сустава: исследование ERADIAS. Энн Реум Дис 73: 376–384. doi: 10.1136/annrheumdis-2012-202485
[24] Чжан В., Доэрти М., Арден Н. и др. (2005) Основанные на доказательствах рекомендации EULAR по лечению остеоартрита тазобедренного сустава: отчет целевой группы Постоянного комитета EULAR по международным клиническим исследованиям, включая терапию (ESCISIT). Энн Реум Дис 64: 669–681. doi: 10.1136/ard.2004.028886
[25] Макалиндон Т., Баннуру Р., Салливан М. и др. (2014) Рекомендации OARSI по нехирургическому лечению остеоартрита коленного сустава. Костный хрящ 22: 363–388. doi: 10.1016/j.joca.2014.01.003
[26] Мсика П., Бодуан С., Сонуа А. и др.(2008) Неомыляемый продукт из авокадо/соевых бобов, ASU EXPANSCIENCE TM , строго отличается от нутрицевтических продуктов, заявленных как ASU. Костный хрящ 16: 1275–1276. doi: 10.1016/j.joca.2008.02.017
[27] Henrotin Y (2008) Неомыляемый продукт авокадо/сои (ASU) для лечения остеоартрита: уточнение. Остеоартрит Хрящ 16: 1118–1119. doi: 10.1016/j.joca.2008.01.010
[28] Rancurel A (1985) Parfums, cosmétiques, Arômes 61: 91.
[29] Farines M, Soulier J, Rancurel A, et al.(1995) Влияние обработки масла авокадо на природу некоторых неомыляемых компонентов. J Am Oil Chem Soc 72: 473–476. дои: 10.1007/BF02636092
[30] Bailet A (1995) Фармацевтический экспертный отчет. Курбевуа, Франция: Pharmascience, 1995 (неопубликованные данные).
[31] Мовьель А., Дайро М., Хартман Д.Дж. и др.(1989) Влияние неомыляемых веществ авокадо/сои (PIAS) на производство коллагена в культурах синовиоцитов, суставных хондроцитов и кожных фибробластов. Rev Rhum 56: 207–213.
[32] Mauviel A, Loyau G, Pujol JP (1991) Эффекты неомыляемых соединений авоката/сои (Piascledine) на коллагенолитическую активность культур синовиоцитов rhumatoides humans и хондроцитов articulaires de lapin traités par l’interleukine-1. Rev Rhum 58: 241–248.
[33] Harmand MF (1985) Исследование неомыляемой фракции авокадо и сои на культурах суставных хондроцитов. Газ Мед Фт 92: 1–3.
[34] Henrotin Y, Labasse A, Jaspar JM, et al.(1998) Влияние трех неомыляемых смесей авокадо/сои на выработку металлопротеиназ, цитокинов и простагландина E2 суставными хондроцитами человека. клин. Ревматол 17: 31–39. дои: 10.1007/BF01450955
[35] Henrotin Y, Sanchez C, Deberg MA, et al. (2003) Неомыляемые вещества авокадо/сои увеличивают синтез аггрекана и снижают выработку катаболических и провоспалительных медиаторов остеоартритными хондроцитами человека. Дж. Ревматол 30: 1825–1834
[36] Габай О., Госсет М., Леви А. и др. (2008)Стресс-индуцированные сигнальные пути в гиалиновых хондроцитах: ингибирование неомыляемыми соединениями авокадо-сои (ASU). Костный хрящ 16: 373–384. doi: 10.1016/j.joca.2007.06.016
[37] Бумедьен К., Фелисаз Н., Богданович П. и соавт.(1999) Неомыляемые соединения авокадо/сои усиливают экспрессию трансформирующих факторов роста бета1 и бета2 в культивируемых суставных хондроцитах. Ревматоидный артрит 42: 148–156. doi: 10.1002/1529-0131(199901)42:13.0.CO;2-U
[38] Кэмпбелл И.К., Войта Дж., Новак Ю. и др. (1994) Цитокиновая модуляция продукции ингибитора активатора плазминогена-1 (PAI-1) суставным хрящом и хондроцитами человека: подавление факторами некроза опухоли. Биохим Биофиз Acta 1226: 277–285. дои: 10.1016/0925-4439(94)-8
[39] Хайял М.Т., Эль-Газали М.А. (1998) Возможный «хондропротекторный» эффект неомыляемых компонентов авокадо и сои in vivo. Drugs Exp Clin Res 24: 41–50.
[40] Boileau C, Martel-Pelletier J, Caron J, et al.(2009)Защитное действие общей фракции неомыляемых соединений авокадо/сои на структурные изменения при экспериментальном остеоартрите собак: ингибирование синтазы оксида азота и матриксной металлопротеиназы-13. Артрит Res Ther 11: 41. doi: 10.1186/ar2649
[41] Джабери Ф., Тахами М., Торабинежад С. и др.(2012) Лечебный эффект смеси соевых бобов и авокадо на дефекты коленного хряща на модели собаки. Комп. Клин Патол 21: 661–666. дои: 10.1007/s00580-010-1152-9
[42] Алтинел Л., Саритас З.К., Козе К.С. и соавт. (2007) Лечение неомыляемыми экстрактами авокадо и сои повышает уровни TGF-бета1 и TGF-бета2 в суставной жидкости собак. Tohoku J Exp Med 211: 181–186. doi: 10.1620/тем.211.181
[43] Торт М., Рид Р., Гийу Б. и др. (2008) Модификация патологии суставного хряща и субхондральной кости в модели остеоартрита овечьей менискэктомии с помощью неомыляемых соединений авокадо и сои (ASU). Костный хрящ 8: 404–411.
[44] Чинелли М., Гвидуччи С., Дель Россо А. и др. (2006)Пиаскледин модулирует продукцию VEGF и TIMP-1 и снижает инвазивность синовиоцитов ревматоидного артрита. Scand J Rheumatol 35: 346–350. дои: 10.1080/03009740600709865
[45] Henrotin Y, Deberg M, Crielaard JM, et al.(2006)Неомыляемые вещества авокадо/сои предотвращают ингибирующее действие остеоартритных субхондральных остеобластов на синтез аггрекана и коллагена II типа хондроцитами. Дж. Ревматол 33: 1668–1678.
[46] Санчес С., Деберг М., Пиккарди Н. и др. (2005) Остеобласты из склеротической субхондральной кости подавляют аггрекан, но повышают экспрессию металлопротеиназ хондроцитами.Этот эффект имитируют несклеротические остеобласты, предварительно обработанные интерлейкином-6, -1бета и онкостатином М. Костный хрящ 13: 979–987.
[47] Санчес С., Деберг М., Пиккарди Н. и др. (2004) Интерлейкин-1, интерлейкин-6 и онкостатин М стимулируют нормальные субхондральные остеобласты, вызывая деградацию хряща. Тележка остеоартрита 12: S98.
[48] Андриаманалиджаона Р., Бенато Х., Барре П.Е. и др. (2006)Влияние интерлейкина-1бета на экспрессию трансформирующего фактора роста-бета и костного морфогенетического белка-2 в периодонтальной связке человека и клетках альвеолярной кости в культуре: модуляция неомыляемыми соединениями авокадо и сои. J Пародонтол 77: 1156–1166.doi: 10.1902/jop.2006.050356
[49] Day JS, van der Linden JC, Bank RA, et al. (2004)Адаптация субхондральной кости при остеоартрите. Биореология 41: 359–368.
[50] Westacott CI, Webb GR, Warnock MG, et al.(1997)Изменение метаболизма хряща клетками остеоартритной кости. Ревматоидный артрит 40: 1282–1291. doi: 10.1002/1529-0131(199707)40:73.0.CO;2-E
[51] Хилал Г., Массикотт Ф., Мартель-Пеллетье Дж. и др. (2001) Эндогенный простагландин Е2 и инсулиноподобный фактор роста 1 могут модулировать уровни рецептора паратиреоидного гормона в остеобластах человека при остеоартрите. J Bone Miner Res 16: 713–721. doi: 10.1359/jbmr.2001.16.4.713
[52] Hilal G, Martel-Pelletier J, Pelletier JP, et al. (1999)Аномальная регуляция активатора урокиназы плазминогена инсулиноподобным фактором роста 1 в субхондральных остеобластах человека при остеоартрите. Ревматоидный артрит 42: 2112–2122.doi: 10.1002/1529-0131(199910)42:103.0.CO;2-N
[53] Massicotte F, Fernandes JC, Martel-Pelletier J, et al. (2006) Модуляция уровней инсулиноподобного фактора роста 1 в остеобластах субхондральной кости человека с остеоартритом. Кость 38: 333–341. doi: 10.1016/j.bone.2005.09.007
[54] Hilal G, Martel-Pelletier J, Pelletier JP, et al.(1998) Остеобластоподобные клетки субхондральной остеоартритной кости человека демонстрируют измененный фенотип in vitro: возможная роль в склерозе субхондральной кости. Ревматоидный артрит 41: 891–899. doi: 10.1002/1529-0131(199805)41:53.0.CO;2-X
[55] Harris SE, Bonewald LF, Harris MA, et al. (1994)Влияние трансформирующего фактора роста на образование костных узелков и экспрессию костного морфогенетического белка 2, остеокальцина, остеопонтина, щелочной фосфатазы и мРНК коллагена I типа в долгосрочных культурах остеобластов свода свода плода крысы. J Bone Miner Res 9: 855–863.

Польза для здоровья, побочные эффекты, применение, дозы и меры предосторожности

Appelboom, T., Schuermans, J., Verbruggen, G., Henrotin, Y. и Reginster, JY. Симптоматическое модифицирующее действие неомыляемых соединений авокадо / сои (ASU) при остеоартрите коленного сустава. Двойное слепое проспективное плацебо-контролируемое исследование. Scand J Rheumatol 2001;30(4):242-247. Посмотреть реферат.

Бланко, К., Carrillo, T., Castillo, R., Quiralte, J., и Cuevas, M. Гиперчувствительность к авокадо. Аллергия 1994;49(6):454-459. Посмотреть реферат.

Блотман Ф., Маэу Э., Вулвик А., Каспард Х. и Лопес А. Эффективность и безопасность неомыляемых соединений авокадо/сои при лечении симптоматического остеоартрита коленного и тазобедренного суставов. Проспективное многоцентровое трехмесячное рандомизированное двойное слепое плацебо-контролируемое исследование. Rev Rhum Engl Ed 1997;64(12):825-834. Посмотреть реферат.

Бумедьен, К., Felisaz, N., Bogdanowicz, P., Galera, P., Guillou, G.B., и Pujol, J.P. Неомыляемые соединения авокадо/сои усиливают экспрессию трансформирующего фактора роста бета1 и бета2 в культивируемых суставных хондроцитах. Ревмирующий артрит. 1999;42(1):148-156. Посмотреть реферат.

Buoro, I.B., Nyamwange, S.B., Chai, D., and Munyua, S.M. Предполагаемая токсичность авокадо у двух собак. Ондерстепорт J.Vet.Res. 1994;61(1):107-109. Посмотреть реферат.

Бургер, В.П., Науд, Т.В., ван Ренсбург, И.Б., Бота, К.J. и Pienaar, AC. Кардиомиопатия у страусов (Struthio camelus) из-за интоксикации авокадо (Persea americana var. guatemalensis). JSAfr.Vet.Assoc. 1994;65(3):113-118. Посмотреть реферат.

Карранса-Мадригал, Дж., Эррера-Абарка, Дж.Э., Альвизури-Муньос, М., Альварадо-Хименес, М.Р., и Чавес-Карбахаль, Ф. Эффекты вегетарианской диеты по сравнению с вегетарианской диетой, обогащенной авокадо, при гиперхолестеринемии пациенты. Арх.мед.рез. 1997;28(4):537-541. Посмотреть реферат.

Крейгмилл, А.Л., Эйде, Р. Н., Шульц, Т. А., и Хедрик, К. Токсичность листьев авокадо (Persea americana (Guatamalan var)): обзор и предварительный отчет. Вет.Гум.Токсикол. 1984;26(5):381-383. Посмотреть реферат.

Craigmill, A.L., Seawright, A.A., Mattila, T., и Frost, A.J. Патологические изменения в молочной железе и биохимические изменения в молоке козы после перорального приема листьев авокадо (Persea americana). Aust.Vet.J. 1989;66(7):206-211. Посмотреть реферат.

Криси Г. и Бельсито Д.V. Контактная крапивница от латекса у больного с гиперчувствительностью немедленного типа к банану, авокадо и персику. Контактный дерматит 1993;28(4):247-248. Посмотреть реферат.

de Groot, A.C., van der Meeren, H.L., and Weyland, J.W. Контактная аллергия на масло авокадо в солнцезащитном креме. Контактный дерматит 1987;16(2):108-109. Посмотреть реферат.

Ernst, E. Неомыляемые соединения авокадо-сои (ASU) при остеоартрите – систематический обзор. Клин.Ревматол. 2003;22(4-5):285-288. Посмотреть реферат.

Хенротин Ю.E., Labasse, AH, Jaspar, JM, De Groote, DD, Zheng, SX, Guillou, GB, и Reginster, JY. Влияние трех неомыляемых смесей авокадо/сои на металлопротеиназы, цитокины и простагландин E2, вырабатываемые суставными хондроцитами человека. Клин.Ревматол. 1998;17(1):31-39. Посмотреть реферат.

Khayyal, MT и el Ghazaly, MA Возможный «хондропротекторный» эффект неомыляемых компонентов авокадо и сои in vivo. Наркотики Exp.Clin.Res. 1998;24(1):41-50.Посмотреть реферат.

Ким, О. К., Мураками, А., Накамура, Ю., и Огигаси, Х. Скрининг съедобных японских растений на активность ингибирования образования оксида азота в клетках RAW 264.7. Рак Летт. 3-13-1998; 125(1-2):199-207. Посмотреть реферат.

Ким О.К., Мураками А., Накамура Ю., Такеда Н., Йошизуми Х. и Огаси Х. Новые ингибиторы образования оксида азота и супероксида, персенон А и В, из плодов авокадо. J.Agric.Food Chem. 2000;48(5):1557-1563. Посмотреть реферат.

Кут, К., Ассуму, А., Дриди, М., Боннефуа, М., Гогли, Б., Пелла, Б., Гийу, Г.Б., и Годо, Г. Морфометрический анализ деградации эластичных волокон десны человека под действием защитного эффекта эластазы лейкоцитов человека неомыляемые вещества авокадо и сои (ASU). Pathol.Biol.(Paris) 1998;46(7):571-576. Посмотреть реферат.

Кут-Лассер, К., Миллер, С.С., Эджейл, А.Л., Гогли, Б., Дриди, М., Пиккарди, Н., Гийу, Б., Пелла, Б. и Годо, Г. Влияние авокадо и неомыляемые соединения сои на желатиназу А (ММР-2), стромелизин 1 (ММР-3) и тканевые ингибиторы матриксной металлопротеиназы (.Дж. Пародонтол. 2001;72(12):1685-1694. Посмотреть реферат.

Mauviel, A., Loyau, G., и Pujol, J.P. [Влияние неомыляемых экстрактов авокадо и сои (Piascledine) на коллагенолитическое действие культур ревматоидных синовиоцитов человека и суставных хондроцитов кролика, обработанных интерлейкином-1]. Rev.Rhum.Mal Osteoartic. 1991;58(4):241-245. Посмотреть реферат.

Маккензи, Р. А. и Браун, О. П. Отравление лошадей авокадо (Persea americana). Aust.Vet.J. 1991;68(2):77-78.Посмотреть реферат.

Сани Ю., Этвелл Р. Б. и Сиврайт А. А. Кардиотоксичность листьев авокадо. Aust.Vet.J. 1991;68(4):150-151. Посмотреть реферат.

Stadler, P., van Rensburg, I.B., и Naude, T.W. Подозрение на отравление авокадо (Persea americana) у коз. JSAfr.Vet.Assoc. 1991;62(4):186-188. Посмотреть реферат.

Верман М.Дж., Мокади С., Нееман И., Ауслендер Л. и Зейдлер А. Влияние масел авокадо на некоторые характеристики печени у растущих крыс. Пищевая хим.Токсикол. 1989;27(5):279-282. Посмотреть реферат.

Верман М.Дж., Мокади С., Нимни М.Е. и Ниман И. Влияние различных масел авокадо на метаболизм коллагена кожи. Connect.Tissue Res. 1991;26(1-2):1-10. Посмотреть реферат.

Яакобович Ю. и Нееман И. Частичное выделение и характеристика гемагглютинирующего фактора из семян авокадо. Arch.Toxicol.Suppl 1983; 6:52-57. Посмотреть реферат.

Зусман И., Гуревич П., Мадар З., Ныска А., Король Д., Тимар Б. и Цукерман А.Опухолестимулирующие и противоопухолевые эффекты диет с высоким содержанием жиров на химически индуцированный рак молочной железы у крыс. Противораковый Рез. 1997;17(1А):349-356. Посмотреть реферат.

Ahlroth, M., Alenius, H., Turjanmaa, K., Makinen-Kiljunen, S., Reunala, T. и Palosuo, T. Перекрестно реагирующие аллергены в латексе натурального каучука и авокадо. J.Allergy Clin.Иммунол. 1995;96(2):167-173. Посмотреть реферат.

Alvizouri-Munoz M, Carranza-Madrigal J, Herrera-Abarca JE, et al. Влияние авокадо как источника мононенасыщенных жирных кислот на уровень липидов в плазме.Arch Med Res 1992; 23:163-7. Посмотреть реферат.

Андрес А., Моралес Дж.М., Прага М. и др. L-аргинин обращает антинатрийуретический эффект циклоспорина у пациентов с трансплантацией почки. Nephrol Dial Transplant 1997; 12:1437-40. Посмотреть реферат.

Бланко С., Диас-Пералес А., Коллада С. и др. Хитиназы класса I как потенциальные паналлергены, участвующие в латексно-фруктовом синдроме. J Allergy Clin Immunol 1999;103(3 Pt 1):507-13.

Бликштейн Д., Шаклай М., Инбал А. Антагонизм варфарина от авокадо.Ланцет 1991;337:914-5.

Карранса Дж., Альвизури М., Альварадо М.Р. и др. [Влияние авокадо на уровень липидов в крови у пациентов с дислипидемиями фенотипа II и IV]. Arch Inst Cardiol Mex 1995; 65: 342-8. Посмотреть реферат.

Colquhoun DM, Moores D, Somerset SM, Humphries JA. Сравнение влияния на липопротеины и аполипопротеины диеты с высоким содержанием мононенасыщенных жирных кислот, обогащенной авокадо, и диеты с высоким содержанием углеводов. Ам Дж. Клин Нутр 1992; 56: 671-7. Посмотреть реферат.

Диас-Пералес А., Коллада С., Бланко С. и др. Перекрестные реакции при латексно-фруктовом синдроме: важная роль хитиназ, но не сложных гликанов, связанных с аспарагином. J Allergy Clin Immunol 1999;104:681-7. Посмотреть реферат.

Henrotin YE, Sanchez C, Deberg MA, et al. Неомыляемые соединения авокадо/сои увеличивают синтез аггрекана и снижают выработку катаболических и провоспалительных медиаторов остеоартритными хондроцитами человека. Дж. Ревматол 2003; 30:1825-34. Посмотреть реферат.

Лекен М., Маэ Э., Кадет С., Драйзер Р.Л.Структурное влияние неомыляемых соединений авокадо/сои на потерю суставной щели при остеоартрите тазобедренного сустава. Arthritis Rheum 2002;47:50-8.. Посмотреть аннотацию.

Лерман-Гарбер И., Ичазо-Серро С., Самора-Гонсалес Дж. и др. Эффект диеты с высоким содержанием мононенасыщенных жиров, обогащенной авокадо, у пациентов с NIDDM. Лечение диабета 1994;17:311-5. Посмотреть реферат.

Лопес Ледесма Р., Фрати Мунари AC, Эрнандес Домингес BC и др. Диета, богатая мононенасыщенными жирными кислотами (авокадо), при умеренной гиперхолестеринемии.Arch Med Res 1996; 27:519-23. Посмотреть реферат.

Maheu E, Mazieres B, Valat JP и др. Симптоматическая эффективность неомыляемых соединений авокадо/сои при лечении остеоартрита коленного и тазобедренного суставов: проспективное, рандомизированное, двойное слепое, плацебо-контролируемое, многоцентровое клиническое исследование с шестимесячным периодом лечения и двухмесячным последующим наблюдением, демонстрирующее стойкий эффект. Артрит Реум 1998; 41:81-91. Посмотреть реферат.

Naveh E, Werman MJ, Sabo E, Neeman I. Обезжиренная мякоть авокадо снижает массу тела и общее количество печеночного жира, но повышает уровень холестерина в плазме у самцов крыс, получавших пищу с холестерином.J Nutr 2002;132:2015-8.. Посмотреть аннотацию.

Stucker M, Memmel U, Hoffmann M, et al. Крем с витамином B(12), содержащий масло авокадо, для лечения бляшечного псориаза. Дерматология 2001;203:141-7. Посмотреть реферат.

Как неомыляемые соединения авокадо и сои могут облегчить боль при остеоартрите

Остеоартрит (ОА) — это хроническое артритное заболевание, характеризующееся болью и тугоподвижностью суставов, вызванными прогрессирующей эрозией суставного хряща, ремоделированием кости, образованием новой кости и воспалением синовиальной оболочки (1).   Наиболее часто поражаются суставы коленей, кистей и бедер, хотя это может произойти с любым суставом. Состояние затрагивает более 1,9 миллиона австралийцев. Замена тазобедренного сустава из-за ОА составляет почти 50% экономических затрат при ОА в Австралии (2).

Нет лекарства от ОА, но данные показывают, что неомыляемые соединения авокадо и соевых бобов (ASU) могут быть эффективным средством для лечения симптомов ОА, поскольку они обладают мощными хондропротекторными, анаболическими, антикатаболическими и противовоспалительными свойствами.ASUs клинически уменьшают боль и скованность в суставах, помогая улучшить функцию суставов. Он также активно предотвращает дальнейшие симптомы ОА. Сообщается, что природные средства, такие как ASU, более безопасны для уменьшения симптомов ОА, чем отпускаемые по рецепту лекарства, которые, как известно, имеют неблагоприятные побочные эффекты. Он также ингибирует абсорбцию холестерина и биосинтез эндогенного холестерина (3).

Неомыляемые вещества авокадо и сои (ASU) — это растительный экстракт, состоящий на одну треть из масла авокадо и на две трети из соевого масла.Смесь ВРУ содержит полиолы (15%), стеролы (4–20%), длинноцепочечные насыщенные углеводороды (5%), сквален (4%), насыщенные углеводороды (1%) и алифатические спирты (<1%). (1). Метод приготовления ASU включает холодный отжим сырых масел авокадо и сои при температуре ниже 50°C и экстракцию неомыляемых липидов путем омыления, экстракции и очистки. При 20°C ASU представляет собой нерастворимую в воде маслянистую густую пасту (1).

Клинические испытания

Было проведено не менее шести рандомизированных двойных слепых исследований эффективности ASU в течение трех и шести месяцев.Испытания показали положительные результаты в отношении уменьшения симптомов ОА тазобедренного и коленного суставов. В 3-летнем двойном слепом плацебо-контролируемом исследовании была проверена эффективность неомыляемого авокадо и соевых бобов-Expanscience (ASU-E) в замедлении прогрессирования ОА тазобедренного сустава. Исследователи пришли к выводу, что 3-летнее лечение ASU-E снижает процент прогрессирующих изменений ширины суставной щели, что позволяет предположить, что ASU-E, возможно, оказывает структурно-модифицирующее действие при ОА тазобедренного сустава (2).

Описание клинических исследований (5)

Исследование №пациентов Включение критерии Группы лечения и сопутствующие лечения Основные конечные точки
1 Н = 164
Возраст: 45-80 лет
– ASU 300 мг/день
– Плацебо

На 3 месяца.


Остеоартроз тазобедренного сустава
2 N = 164
Возраст: 45-75 лет
– ПИАСКЛЕДИН 300 мг/день
– Плацебо

В течение 6 месяцев, затем 2 месяца последующего наблюдения.

Артроз тазобедренного сустава
3 N = 260
Возраст: 45-80 лет
– ASU 300 мг/день
– ASU 600 мг/день
– Плацебо

На 3 месяца.

Односторонний или двусторонний бедренно-большеберцовый остеоартроз
4 N = 182
Возраст > 45 лет
– ASU
– Плацебо

На 6 месяцев.

Бедробольшеберцовый остеоартроз
5 N = 187
Возраст > 45 лет
– ASU
– Плацебо

На 6 месяцев.

Верхний полярный остеоартроз тазобедренного сустава
6 N = 128
Возраст: 45 – 80 лет
– АСУ
– Диацереин

На 3 мес.

бедренно-большеберцовый остеоартрит

Неомыляемые вещества авокадо и сои (ASU) представляют собой растительный экстракт, состоящий на одну треть из масла авокадо и на две трети из соевого масла.

Как работает ASU

Механизм действия ASU включает увеличение содержания коллагена в тканях, повышение уровня липидов в тканях и значительное увеличение доли экстрагируемых компонентов.АСУ в целом обладает более мощным синергетическим эффектом, чем каждый из его компонентов в отдельности (1).

ASU, как полагают, предотвращает вызванное ОА остеобластами ингибирование производства молекул матрикса, что позволяет предположить, что это соединение может поддерживать восстановление хряща при ОА, воздействуя на остеобласты субхондральной кости (4) . Остеобласты — это крупные клетки, ответственные за формирование новых костей и синтез коллагеновой матрицы для увеличения прочности костей.

Хондропротекторные, анаболические и антикатаболические свойства ASU подавляют разрушение хряща и способствуют восстановлению хряща путем ингибирования молекул и путей, вовлеченных в OA (3) .

Как показали исследования, ASU является эффективной альтернативой для облегчения боли и скованности, вызванных остеоартритом, без проблем с безопасностью, часто связанных с лекарствами, отпускаемыми по рецепту. Его естественный медленнодействующий агент не только устраняет острую боль, связанную с ОА, но также помогает предотвратить дальнейшие симптомы ОА.

Возможные комбинации ВСУ включают кошачий коготь, имбирь, витамин С, витамин Е и марганец.

Если вам понравилось читать этот блог, присоединитесь к нашему списку рассылки , чтобы быть в курсе последних новостей и информации о здоровье и дополнительной медицине.

Список литературы

1.Salehi B, Rescigno A, Dettori T, et al. Неомыляемые вещества авокадо-сои: множество потенциальных возможностей, которые необходимо использовать. Биомолекулы . 2020;10(1):130. doi:10.3390/biom10010130

2.Maheu E, Cadet C, Marty M, et al. Рандомизированное контролируемое исследование влияния неомыляемых соединений авокадо-сои (пиаскледин) на структурную модификацию при остеоартрите тазобедренного сустава: исследование ERADIAS. Энн Реум Дис . 2014;73(2):376-384.doi:10.1136/annrheumdis-2012-202485

3.Кристиансен Б.А., Бхатти С., Гударзи Р., Эмами С. Лечение остеоартрита с помощью неомыляемых веществ авокадо/сои. Хрящ . 2015;6(1):30-44. doi:10.1177/1947603514554992

4.Christensen R, Bartels EM, Astrup A, Bliddal H. Симптоматическая эффективность неомыляемых соединений авокадо-сои (ASU) у пациентов с остеоартритом (OA): метаанализ рандомизированных контролируемых исследований. Остеоартрит Хрящ . 2008 Апрель; 16 (4): 399-408.doi: 10.1016/j.joca.2007.10.003. Epub 2007, 26 ноября. PMID: 18042410.

5.Haute Autorité de Santé, Неомыляемые вещества масла авокадо, неомыляемые вещества соевого масла, ноябрь 2009 

Использование, преимущества, побочные эффекты, дозы, меры предосторожности и предупреждения

Appelboom, T., Schuermans, J., Verbruggen, G., Henrotin, Y. и Reginster, JY. Симптоматическое модифицирующее действие неомыляемых соединений авокадо / сои (ASU) при остеоартрите коленного сустава. Двойное слепое проспективное плацебо-контролируемое исследование.Scand J Rheumatol 2001;30(4):242-247. Посмотреть реферат.

Бланко К., Каррильо Т., Кастильо Р., Киральте Дж. и Куэвас М. Гиперчувствительность к авокадо. Аллергия 1994;49(6):454-459. Посмотреть реферат.

Блотман Ф., Маэу Э., Вулвик А., Каспард Х. и Лопес А. Эффективность и безопасность неомыляемых соединений авокадо/сои при лечении симптоматического остеоартрита коленного и тазобедренного суставов. Проспективное многоцентровое трехмесячное рандомизированное двойное слепое плацебо-контролируемое исследование. Rev Rhum Engl Ed 1997;64(12):825-834.Посмотреть реферат.

Boumedien, K., Felisaz, N., Bogdanowicz, P., Galera, P., Guillou, G.B., и Pujol, J.P. Неомыляемые соединения авокадо/сои усиливают экспрессию трансформирующего фактора роста бета1 и бета2 в культивируемых суставных хондроцитах. Ревмирующий артрит. 1999;42(1):148-156. Посмотреть реферат.

Buoro, I.B., Nyamwange, S.B., Chai, D., and Munyua, S.M. Предполагаемая токсичность авокадо у двух собак. Ондерстепорт J.Vet.Res. 1994;61(1):107-109. Посмотреть реферат.

Бургер, В.P., Naude, T.W., van Rensburg, I.B., Botha, CJ, and Pienaar, AC. Кардиомиопатия у страусов (Struthio camelus) из-за интоксикации авокадо (Persea americana var. guatemalensis). JSAfr.Vet.Assoc. 1994;65(3):113-118. Посмотреть реферат.

Карранса-Мадригал, Дж., Эррера-Абарка, Дж.Э., Альвизури-Муньос, М., Альварадо-Хименес, М.Р., и Чавес-Карбахаль, Ф. Эффекты вегетарианской диеты по сравнению с вегетарианской диетой, обогащенной авокадо, при гиперхолестеринемии пациенты. Арх.мед.рез. 1997;28(4):537-541.Посмотреть реферат.

Крейгмилл, А.Л., Эйде, Р.Н., Шульц, Т.А., и Хедрик, К. Токсичность листьев авокадо (Persea americana (Guatamalan var)): обзор и предварительный отчет. Вет.Гум.Токсикол. 1984;26(5):381-383. Посмотреть реферат.

Craigmill, A.L., Seawright, A.A., Mattila, T., и Frost, A.J. Патологические изменения в молочной железе и биохимические изменения в молоке козы после перорального приема листьев авокадо (Persea americana). Aust.Vet.J. 1989;66(7):206-211.Посмотреть реферат.

Crisi, G. и Belsito, D.V. Контактная крапивница от латекса у пациента с немедленной гиперчувствительностью к банану, авокадо и персику. Контактный дерматит 1993;28(4):247-248. Посмотреть реферат.

de Groot, A.C., van der Meeren, H.L., and Weyland, J.W. Контактная аллергия на масло авокадо в солнцезащитном креме. Контактный дерматит 1987;16(2):108-109. Посмотреть реферат.

Ernst, E. Неомыляемые соединения авокадо-сои (ASU) при остеоартрите – систематический обзор. Клин.Ревматол.2003;22(4-5):285-288. Посмотреть реферат.

Henrotin, YE, Labasse, AH, Jaspar, JM, De Groote, DD, Zheng, SX, Guillou, GB, and Reginster, JY Влияние трех неомыляемых смесей авокадо/сои на выработку металлопротеиназ, цитокинов и простагландина E2 суставами человека хондроциты. Клин.Ревматол. 1998;17(1):31-39. Посмотреть реферат.

Khayyal, MT и el Ghazaly, MA Возможный «хондропротекторный» эффект неомыляемых компонентов авокадо и сои in vivo.Наркотики Exp.Clin.Res. 1998;24(1):41-50. Посмотреть реферат.

Ким, О. К., Мураками, А., Накамура, Ю., и Огигаси, Х. Скрининг съедобных японских растений на активность ингибирования образования оксида азота в клетках RAW 264.7. Рак Летт. 3-13-1998; 125(1-2):199-207. Посмотреть реферат.

Ким О.К., Мураками А., Накамура Ю., Такеда Н., Йошизуми Х. и Огаси Х. Новые ингибиторы образования оксида азота и супероксида, персенон А и В, из плодов авокадо. J.Agric.Food Chem. 2000;48(5):1557-1563.Посмотреть реферат.

Кут, К., Ассуму, А., Дриди, М., Боннефуа, М., Гогли, Б., Пелла, Б., Гийу, Г.Б. и Годо, Г. Морфометрический анализ деградации эластичных волокон десны человека при Защитный эффект неомыляемых веществ авокадо и сои (ASU) на эластазу лейкоцитов человека. Pathol.Biol.(Paris) 1998;46(7):571-576. Посмотреть реферат.

Кут-Лассер, К., Миллер, С.С., Эджейл, А.Л., Гогли, Б., Дриди, М., Пиккарди, Н., Гийу, Б., Пелла, Б. и Годо, Г. Влияние авокадо и неомыляемые соединения сои на желатиназу А (ММР-2), стромелизин 1 (ММР-3) и тканевые ингибиторы матриксной металлопротеиназы (.Дж. Пародонтол. 2001;72(12):1685-1694. Посмотреть реферат.

Mauviel, A., Loyau, G., и Pujol, J.P. [Влияние неомыляемых экстрактов авокадо и сои (Piascledine) на коллагенолитическое действие культур ревматоидных синовиоцитов человека и суставных хондроцитов кролика, обработанных интерлейкином-1]. Rev.Rhum.Mal Osteoartic. 1991;58(4):241-245. Посмотреть реферат.

Маккензи, Р. А. и Браун, О. П. Отравление лошадей авокадо (Persea americana). Aust.Vet.J. 1991;68(2):77-78.Посмотреть реферат.

Сани Ю., Этвелл Р. Б. и Сиврайт А. А. Кардиотоксичность листьев авокадо. Aust.Vet.J. 1991;68(4):150-151. Посмотреть реферат.

Stadler, P., van Rensburg, I.B., и Naude, T.W. Подозрение на отравление авокадо (Persea americana) у коз. JSAfr.Vet.Assoc. 1991;62(4):186-188. Посмотреть реферат.

Верман М.Дж., Мокади С., Нееман И., Ауслендер Л. и Зейдлер А. Влияние масел авокадо на некоторые характеристики печени у растущих крыс. Пищевая хим.Токсикол. 1989;27(5):279-282. Посмотреть реферат.

Верман М.Дж., Мокади С., Нимни М.Е. и Ниман И. Влияние различных масел авокадо на метаболизм коллагена кожи. Connect.Tissue Res. 1991;26(1-2):1-10. Посмотреть реферат.

Яакобович Ю. и Нееман И. Частичное выделение и характеристика гемагглютинирующего фактора из семян авокадо. Arch.Toxicol.Suppl 1983; 6:52-57. Посмотреть реферат.

Зусман И., Гуревич П., Мадар З., Ныска А., Король Д., Тимар Б. и Цукерман А.Опухолестимулирующие и противоопухолевые эффекты диет с высоким содержанием жиров на химически индуцированный рак молочной железы у крыс. Противораковый Рез. 1997;17(1А):349-356. Посмотреть реферат.

Ahlroth, M., Alenius, H., Turjanmaa, K., Makinen-Kiljunen, S., Reunala, T. и Palosuo, T. Перекрестно реагирующие аллергены в латексе натурального каучука и авокадо. J.Allergy Clin.Иммунол. 1995;96(2):167-173. Посмотреть реферат.

Alvizouri-Munoz M, Carranza-Madrigal J, Herrera-Abarca JE, et al. Влияние авокадо как источника мононенасыщенных жирных кислот на уровень липидов в плазме.Arch Med Res 1992; 23:163-7. Посмотреть реферат.

Андрес А., Моралес Дж.М., Прага М. и др. L-аргинин обращает антинатрийуретический эффект циклоспорина у пациентов с трансплантацией почки. Nephrol Dial Transplant 1997; 12:1437-40. Посмотреть реферат.

Бланко С., Диас-Пералес А., Коллада С. и др. Хитиназы класса I как потенциальные паналлергены, участвующие в латексно-фруктовом синдроме. J Allergy Clin Immunol 1999;103(3 Pt 1):507-13.

Бликштейн Д., Шаклай М., Инбал А. Антагонизм варфарина от авокадо.Ланцет 1991;337:914-5.

Карранса Дж., Альвизури М., Альварадо М.Р. и др. [Влияние авокадо на уровень липидов в крови у пациентов с дислипидемиями фенотипа II и IV]. Arch Inst Cardiol Mex 1995; 65: 342-8. Посмотреть реферат.

Colquhoun DM, Moores D, Somerset SM, Humphries JA. Сравнение влияния на липопротеины и аполипопротеины диеты с высоким содержанием мононенасыщенных жирных кислот, обогащенной авокадо, и диеты с высоким содержанием углеводов. Ам Дж. Клин Нутр 1992; 56: 671-7. Посмотреть реферат.

Диас-Пералес А., Коллада С., Бланко С. и др. Перекрестные реакции при латексно-фруктовом синдроме: важная роль хитиназ, но не сложных гликанов, связанных с аспарагином. J Allergy Clin Immunol 1999;104:681-7. Посмотреть реферат.

Henrotin YE, Sanchez C, Deberg MA, et al. Неомыляемые соединения авокадо/сои увеличивают синтез аггрекана и снижают выработку катаболических и провоспалительных медиаторов остеоартритными хондроцитами человека. Дж. Ревматол 2003; 30:1825-34. Посмотреть реферат.

Лекен М., Маэ Э., Кадет С., Драйзер Р.Л.Структурное влияние неомыляемых соединений авокадо/сои на потерю суставной щели при остеоартрите тазобедренного сустава. Arthritis Rheum 2002;47:50-8.. Посмотреть аннотацию.

Лерман-Гарбер И., Ичазо-Серро С., Самора-Гонсалес Дж. и др. Эффект диеты с высоким содержанием мононенасыщенных жиров, обогащенной авокадо, у пациентов с NIDDM. Лечение диабета 1994;17:311-5. Посмотреть реферат.

Лопес Ледесма Р., Фрати Мунари AC, Эрнандес Домингес BC и др. Диета, богатая мононенасыщенными жирными кислотами (авокадо), при умеренной гиперхолестеринемии.Arch Med Res 1996; 27:519-23. Посмотреть реферат.

Maheu E, Mazieres B, Valat JP и др. Симптоматическая эффективность неомыляемых соединений авокадо/сои при лечении остеоартрита коленного и тазобедренного суставов: проспективное, рандомизированное, двойное слепое, плацебо-контролируемое, многоцентровое клиническое исследование с шестимесячным периодом лечения и двухмесячным последующим наблюдением, демонстрирующее стойкий эффект. Артрит Реум 1998; 41:81-91. Посмотреть реферат.

Naveh E, Werman MJ, Sabo E, Neeman I. Обезжиренная мякоть авокадо снижает массу тела и общее количество печеночного жира, но повышает уровень холестерина в плазме у самцов крыс, получавших пищу с холестерином.J Nutr 2002;132:2015-8.. Посмотреть аннотацию.

Stucker M, Memmel U, Hoffmann M, et al. Крем с витамином B(12), содержащий масло авокадо, для лечения бляшечного псориаза. Дерматология 2001;203:141-7. Посмотреть реферат.

Варианты нутрицевтики при остеоартрозе в ортопедии и спортивной медицине

01 декабря 2010 г.

28 минут чтения

ДОБАВИТЬ ТЕМУ В СООБЩЕНИЯ ПО ЭЛЕКТРОННОЙ ПОЧТЕ

Получать электронные письма, когда новые статьи публикуются на

Пожалуйста, укажите свой адрес электронной почты, чтобы получать электронные письма, когда новые статьи публикуются на .Подписаться Нам не удалось обработать ваш запрос. Пожалуйста, попробуйте позже. Если у вас по-прежнему возникает эта проблема, свяжитесь с нами по адресу [email protected]

Назад к Хелио

John Bergfeld, MD: Миллионы пациентов в США страдают состояниями и заболеваниями, связанными с дискомфортом в суставах и разрушение хряща, особенно при остеоартрите (ОА).События в фармакология, такая как нутрицевтики, предлагает новые подходы к здоровью суставов.

Какие факторы влияют на распространенность ОА?

Николас А. Ди Нубиле, MD: Существует множество предрасполагающих факторов для ОА, включая генетику, предшествующую травму, ожирение и пол; у женщин больше заболеваемости ОА, чем у мужчин (рис. 1). 1 Увеличенный срок службы — еще один фактором, который мог бы объяснить более высокую заболеваемость ОА в нашей популяции, т.е. продолжительность жизни, вероятность развития ОА в таких суставах, как коленный или бедро, а также некоторые суставы в руке увеличивается.Несмотря на последствия прогнозируемой продолжительности жизни и заболеваемости ОА, большинство наших суставы не страдают артритом. Очевидно, нам нужно больше узнать об этом многофакторное заболевание.

Данные Американской академии хирургов-ортопедов (AAOS) указывают на значительный рост заболеваемости ОА у лиц в возрасте от 55 лет и 64 года — поколение бэби-бумеров. 2 Эта группа имеет становятся более активными в своем старении, чем предыдущие поколения, и, следовательно, накопил больше травм с течением времени.


Рисунок 1: Скорректированная по возрасту распространенность диагностированных врачом артрит среди взрослых в США в 2007-2009 гг., по полу и телосложению категория индекса массы (ИМТ). У мужчин и женщин распространенность с поправкой на возраст артрит значительно увеличился с увеличением ИМТ ( P Источник: CDC. Распространенность артрита, диагностированного врачом, и связанного с ним артрита ограничение активности — США, 2007–2009 гг. ММВР . 2010;59(39):1261-1265.

Allan H. Morton, DO: Хотя основное внимание в моей практике уделяется для лечения людей с ревматоидным артритом (РА), в настоящее время акцент на лечении пациентов с ОА из-за большого количества больных болезнью, особенно учитывая старение населения бэби-бумеров.

DiNubile: Две группы населения, часто страдающие ОА, те, кто страдает ожирением, и те, кто занимается спортом.Ожирение усиливает эффект поврежденных суставов, особенно если присутствуют проблемы соосности. В зависимости от выполняемой деятельности каждый лишний килограмм веса человека может влияют на колено или бедро, как если бы это было от 5 до 7 лишних фунтов.

«… [T]теперь больше внимания уделяется лечению с ОА из-за количества больных, пораженных этим заболеванием, особенно учитывая старение населения бэби-бумеров.
– Аллан Х. Мортон, DO

У спортсменов часто наблюдается преждевременное старение суставов из-за травм и повторяющееся перенапряжение суставов. В зависимости от вида спорта, признаки артрита видны в разных суставах. Например, по сравнению с людьми, которые не заниматься спортом, футболисты чаще страдают ОА коленного сустава, баскетболисты чаще имеют артритные изменения вокруг лодыжки, танцоры более вероятно, имеют ОА в бедрах, а гимнасты, футбольные лайнсмены и пауэрлифтеры чаще страдают ОА в области позвоночника.В большинстве из них случаях распространенность ОА у этих спортсменов, скорее всего, является следствием повторяющиеся микротравмы. При острой травме, такой как разрыв передней крестообразной связки, ОА все еще распространены, даже с современными малоинвазивными методами восстановления которые обеспечивают довольно предсказуемое восстановление и возвращение в спорт.

Последствия чрезмерного употребления особенно затрагивают бэби-бумеров, которые, как в целом, вести активный образ жизни. Хотя достижения в области здравоохранения и науки увеличили продолжительность жизни человека с 46 лет на рубеже века до почти 80 лет сегодня, наша костно-мышечная структура не развилась достаточно быстро, чтобы приспособиться к более длительной активной жизни.Следовательно, заболеваемость заболевания опорно-двигательного аппарата в этой популяции, включая ОА, и связанные с ним потребность в замене сустава увеличилась.

Джеффри Р. Дугас, доктор медицины: В современном обществе больше внимания уделяется здоровому образу жизни, который включает в себя частые физические упражнения для способствуют здоровому обмену веществ. Каждый американец знает о преимуществах физическими упражнениями, и это привело к огромному улучшению здоровья и физической формы индустрии продвижения, а также в нутрицевтической промышленности.Увеличение участие в упражнениях, частота и интенсивность упражнений растут, что, вероятно, увеличит риск травм среди взрослых, а также Распространенность дегенеративного ОА.

Edward R. McDevitt, MD: Молодые спортсмены получают травмы, которые могут привести к раннему ОА в более позднем возрасте. СТОП (предотвращение спортивных травм и чрезмерного использования) Кампания по борьбе со спортивными травмами, инициированная Американским ортопедическим обществом Спортивная медицина (AOSSM) и Джеймс Р.Эндрюс, доктор медицины, находится в критическом состоянии из-за травм продолжают влиять на пациентов по мере их старения. Если бы травмы можно было предотвратить, пациентов, а также общество, и без того обремененное растущей стоимостью здравоохранение, было бы полезно.

DiNubile: Число травмированных юных спортсменок, особенно с разрывами передней крестообразной связки, значителен. Даже после успешного лечения травмы вероятно, что у этих пациентов разовьется артрит через 20-30 лет.

Claude T. Moorman III, MD: полученные травмы или смещение, которое влияет на сустав, должны также относятся к группе риска ОА. Многие молодые спортсмены получают радиальные разрывы, чтобы латеральный мениск — травма, также распространенная у профессиональных спортсменов. я лечат многих игроков в лакросс и футбол, а также являются одной из областей, подверженных наибольшему риску эти пациенты их колени. Медицинские вмешательства, расширяющие возможности из этих травм должным образом излечить необходимо.

Bergfeld: Какова причина ОА у пациентов, не получавших подвержен механическим воздействиям, связанным с ОА, например, предыдущей травмой, ожирением, злоупотреблять? Существует ли другая этиология, вызывающая разрушение суставного хряща? происходить?

Morton: Разрушение хряща также распространено у людей с наследственный эрозивный ОА, генетически обусловленный ОА или гипермобильность суставов. Несмотря на то, что ОА считается одной болезнью, на самом деле это целый спектр болезней из-за многих этиологии, которые этому способствуют.

Например, первичный ОА не распространен в голеностопном суставе, но обычно обнаруживаются в области бедра и колена. Одна из гипотез, объясняющая эту разницу, состоит в том, что хрящ голеностопного сустава отличается от хряща бедра и колена и, следовательно, сохранен от первичного ОА.

Варианты лечения ОА

Бергфельд: Какие существуют варианты лечения суставов? дискомфорт и разрушение хрящей?

Dugas: У пациентов с ОА коленного сустава мой подход, как правило, многогранный.Пациенты с однокомпонентным заболеванием из-за нагрузки на точка должна носить хорошо подогнанные или изготовленные на заказ скобы разгрузчика, а также ортопедические стельки, такие как вставки для обуви, которые отклоняют пятки от пострадавшего купе. Эти механические варианты являются хорошим дополнением к нутрицевтикам. добавки, инъекции, физиотерапия и НПВП. Я также консультирую пациентов об упражнениях, которые можно выполнять, не подвергая их колоссальному стрессу. суставы нижних конечностей.В частности, я рекомендую плавание и использование лежачие велосипеды, гребные тренажеры и эллиптические тренажеры.

Morton: Как ревматолог, лечащий людей с заболевания опорно-двигательного аппарата, я часто использую методы фиксации, такие как шины, тейп, опоры для спины и разгрузочные наколенники в моей практике. При обсуждении методов лечения с моими пациентами, я рассматриваю четыре типа вариантов: хирургический, нехирургические, немедикаментозные и фармакологические.

«Моей первой линией защиты при лечении ОА является рекомендации консервативных мер, включая нутрицевтики, физические упражнения и потеря веса.”
– Николас А. ДиНубиле, доктор медицины

Прежде чем рекомендовать ортопедическую оценку возможной операции, я нанимаю немедикаментозные варианты, такие как укрепление четырехглавой мышцы, потеря веса или вспомогательные устройства, такие как опоры для коленей и спины.При лечении ОА я рекомендую нутрицевтики, т. е. встречающиеся в природе вещества, которые предложили лекарственные и биологически активные преимущества, потому что они полезны для большинства пациентов. Даже если пациенты указывают, что их первоначальный опыт приема нутрицевтиков не работать, я бы предложил попробовать другой.

Я все еще использую НПВП в своей практике, но я тщательно выбираю своих пациентов, чтобы избежать побочных эффектов. Я часто назначаю сопутствующую гастропротекторную лекарства.Поскольку нет одобренных FDA лекарств для замедления прогрессирование ОА, я рекомендую нутрицевтики как для облегчения симптомов, так и для потенциальная модифицирующая заболевание польза.

DiNubile: Моей первой линией защиты при лечении ОА является рекомендации консервативных мер, включая нутрицевтики, физические упражнения и потеря веса (рис. 2). Для пациентов со значительным отеком, болью или синовита, я также предложу пероральный прием НПВП. Если симптомы пациента упорствую, я ищу дополнительные варианты лечения.

Данные показали, что добавки, повышающие вязкость, более эффективны. на ранних стадиях ОА коленного сустава, чем на поздних стадиях. Для бэби-бумеров или более молодые пациенты, которые не готовы к замене коленного сустава, я использую вискодобавок больше и кортикостероидов меньше, потому что я вижу вискосапплементация как более безопасная долгосрочная стратегия. Потенциальный хондропротектор эффекты более выражены при применении добавок, повышающих вязкость, чем при применении кортикостероидов, которые обеспечивают кратковременное облегчение и при повторном использовании могут нанести вред суставной хрящ.Для пациентов, которым требуется немедленное обезболивание, или тех, при более остром отеке или синовите я буду использовать внутрисуставные стероиды.


Рисунок 2: Образ жизни и варианты фармакологического лечения для ОА.
Источник: Николас А. Ди Нубиле, доктор медицины

Bergfeld: В дополнение к этим рекомендациям я буду рекомендовать одно посещение физиотерапевта для обучения правильной силе тренировка и растяжка суставов.

Используете ли вы инъекции гиалуроновой кислоты (ГК) при лечении пациентов с коленный ОА?

Robert Schenck Jr., MD: Это зависит от пациента и тяжесть его или ее ОА. Например, если пациент пожилого возраста и имеет при сильном артрите коленного сустава, вероятно, потребуется полная замена коленного сустава. Если у пациента ОА и суставной выпот, я могу сначала попробовать аспирацию и инъекция кортикостероидов, ограничивающая транспортное средство.Попробовав это режима, я обычно пробую одну серию инъекций ГК.

Другим фактором, который следует учитывать, является то, что инъекции ГК требуют страховки. одобрение. Некоторые поставщики могут потребовать, чтобы пациент сначала прошел физический осмотр. терапия и инъекции кортикостероидов. Если я лечу молодого, активного пациент с симптомами ОА, который мог получить травму, такую ​​как ACL слезы, я буду использовать инъекции ГК, но не стероид, потому что кортикостероиды было показано, что он вреден для нормального гиалинового хряща.Кроме того, Национальная студенческая спортивная ассоциация не рекомендует кортикостероиды инъекции в колено или плечо обычно для молодых университетских спортсменов.

Moorman: инъекции ГК полезны для пациентов, у которых уже подвергшихся артроскопической процедуре, но еще не являющихся кандидатами на замена сустава. Хотя я чувствую, что больше пациентов получают пользу от использования пероральные нутрицевтики, такие как глюкозамин и хондроитинсульфат с авокадо, соевые неомыляемые вещества (ASU), HA не следует полностью исключать, поскольку альтернативное хирургическому вмешательству лечение у правильно отобранных пациентов.

Morton: Некоторые препараты ГК для перорального и местного применения могут быть рассмотрены нутрицевтики, но ни один из них не показал доказательств эффективности.

Я агрессивно инъекционно употребляю ГК, но мой первоначальный режим лечения фокусируется на применении НПВП и/или анальгетиков в сочетании с нутрицевтиками и физиотерапия. Если пациент не отвечает на лечение в течение 1-2 месяцев, я бы рассмотрел внутрисуставные стероиды. Если пациент не опыт 3 месяца облегчения, я бы подумал об инъекциях ГК.

McDevitt: Я всегда пробую другие варианты лечения перед ГА, потому что потеря веса, специальные упражнения, которые не нагружают вовлеченные суставы и кор укрепление часто облегчает боль пациента. Я хотел бы видеть долгосрочный рандомизированное исследование, в котором сравниваются эффекты ГК с эффектами плацебо.

Опасность использования кортизона, который назначался в течение многих лет как инъекции в суставы, следует отметить. Если кто-нибудь из моих пациентов попросит кортизон, потому что он работал, когда его вводили им 10 лет назад, я бы обучать их более безопасным долгосрочным вариантам.Самая распространенная рекомендация, которую я имею для большинства моих пациентов — это меньше есть и больше заниматься спортом. Через вес сокращение и программа упражнений с низким уровнем воздействия, многие пациенты достигают резкое улучшение боли при артрите. Простой наколенник для также помогает пациентам с артритом коленного сустава. Если эти консервативные меры не увенчались успехом, я рекомендую инъекции ГК.

Мурман: В моей практике есть активные кадры от 50 до 80-летние пациенты, которые не хотят замены суставов и которым это не приносит пользы от артроскопии, которая, основываясь на недавней литературе, относится к пациентам, у которых боль преимущественно связана с артритом. 3

«Нутрицевтики … являются привлекательным вариантом, потому что многие … пациенты уже знакомы с этими методами лечения и удобно ими пользоваться».
– Клод Т. Мурман III, доктор медицины

С точки зрения механики я мог бы использовать разгрузочные скобы для внешне иммобилизовать или разгрузить сустав. Нутрицевтики, такие как глюкозамин и хондроитинсульфат, а в последнее время – формула в сочетании с ASU. привлекательный вариант, поскольку многие из этих пациентов уже знакомы с эти процедуры и комфортно их использовать.Следовательно, это просто вопрос определения того, какой продукт лучше для них.

По мере того, как я больше знакомился с литературой, я также начал считают, что пациенты в возрасте 30 лет с ранними признаками дистальных заболевания межфаланговых суставов может принести пользу от нутрицевтиков.

Bergfeld: Входят ли нутрицевтики в различные химические вещества? категории?

Morton: Нутрицевтики, такие как глюкозамин, хондроитин, АСУ, зеленый чай и марганец имеют больше общего, чем различий относительно механизмов их действия (рис. 3, таблица). 4

Наша цель для наших пациентов — уменьшить боль и воспаление, поддерживать или улучшить функцию и замедлить прогрессирование заболевания, если это возможно. В этой связи, предотвращение повреждения субхондральной кости, хрящей, сужения суставной щели и формирование остеофитов является целью. Что способствует этому повреждению, так это закономерность медиаторов воспаления, которые взаимодействуют таким образом, чтобы вызвать эти вредные эффекты.

Имеются научные данные о том, что нутрицевтики, такие как упомянутые выше, по отдельности или в комбинации, ингибируют многие из этих путей к предотвратить этот воспалительный и деструктивный процесс.Таким образом, когда я запускаю пациента на нутрицевтиках, я надеюсь, что он или она почувствует облегчение симптомов, но мой Основная проблема заключается в изменении естественного течения болезни.

Bergfeld: Может ли нутрицевтик усилить действие нестероидный?

Мортон: Да. Исследования показывают, что потребление нутрицевтиков снижается применение анальгетиков и НПВП. Шкалы боли показали снижение визуального аналога баллы по шкале ВАШ, а функциональный индекс показал улучшение с нутрицевтическое использование. 5,6

Bergfeld: Каковы некоторые потенциальные противопоказания для лекарств и доступны ли немедикаментозные методы лечения ОА?

McDevitt: Противопоказания для НПВП включают: желудочно-кишечное (ЖКТ) кровотечение или неблагоприятное воздействие на почки или печень. Немного пациенты беспокоятся о приеме продукта глюкозамина, потому что у них диабет, но я сообщаю им, что нет данных, подтверждающих эту озабоченность. Я не знаю ни о каких исследованиях которые указывают на то, что употребление нутрицевтиков опасно.В целом, этот вариант лечения кажется относительно безопасным по сравнению с доступной лекарственной терапией.

Я подчеркиваю важность информирования любого медицинского работника о том, что нутрицевтики, которые использует пациент, потому что некоторые нутрицевтики, особенно чеснок, женьшень и гинкго — влияют на время кровотечения. Если используется в сочетании при приеме НПВП увеличивается риск желудочно-кишечных проблем.

DiNubile: Те же пациенты, которые в прошлом нуждались в НПВП таких как рофекоксиб или вальдекоксиб, теперь даже можно избежать использования ибупрофена или напроксен.Хотя некоторые пациенты могут слишком остро реагировать, их опасения по поводу Потенциальные побочные эффекты НПВП понятны. Больной должен учитывать если потенциальная польза для опорно-двигательного аппарата превышает потенциальную риск для сердца, печени, почек и желудка. Я думаю, это правильно быть осторожно с использованием НПВП, и я часто рекомендую своим пациентам уменьшить или прекратить использование НПВП.

АСУ

Bergfeld: Недавние исследования показали, что ASU дополняет эффекты хондроитинсульфата с глюкозамином и защищает хрящ, что приводит к улучшению функции суставов (рис. 3).Оказывает ли анаболический эффект глюкозамин, хондроитинсульфат и АСУ стимулируют хондроциты деятельность? 7-11


Рисунок 3: ASU в сочетании с хондроитинсульфатом, глюкозамин и галлат эпигаллокатехина модулируют воспалительную реакцию и разрушение хрящей.
Источник: Nutramax Laboratories, Inc.

Мортон: Я не уверен, стимулируют ли хондроитин и глюкозамин производство хондроцитов; однако они увеличивают количество протеогликанов, что является частью суставной матрицы.

Хондроитин сульфат оказывает антикатаболическое действие на ферменты, разрушает хрящ и увеличивает синтез ГК, что очевидно важно для совместной композиции. Брюйер и коллеги 12 изучали замена суставов и лечение глюкозамина сульфатом. Исследование лечило участников от 12 месяцев до 3 лет и включало 5-летнее наблюдение. Принадлежащий Пролечено 144 участника, у девяти была полная замена сустава; из 131 участников не лечили, 19 провели полную замену сустава.Таким образом, примерно На 50% меньше пролеченных пациентов подверглись тотальному эндопротезированию суставов.

Bergfeld: Указывают ли данные на то, что сочетание хондроитинсульфата и глюкозамин с ВСУ будет усиливать их действие?

DiNubile: Да. Эта комбинация создает синергию, когда все больше, чем сумма его частей. Так же, как комбинация хондроитина Было показано, что сульфат с глюкозамином более эффективен, чем любой другой агент. само по себе добавление ASU обеспечивает дополнительные синергетические эффекты.Там также по-видимому, более быстрое начало действия с точки зрения симптоматического облегчения, с добавление ВРУ (таблица).


Источник: DiNubile NA. Возможная роль авокадо и пищевые добавки на основе сои в лечении остеоартрит – обзор. Врач и спортивная медицина . 2010;38(2):71-81.
Перепечатано с разрешения JTE. Мультимедиа.

Morton: Глюкозамин положительно влияет на хондроитинсульфат и ASU также имеет много независимых полезных свойств. Глюкозамин хондроитинсульфат в сочетании с АСУ может быть одним из наших лучших болезнь-модифицирующие препараты для лечения остеоартрита (DMOAD). Пяти-, шести- или восьмилучевой исследование, проведенное за большим числом людей, вероятно, потребуется, чтобы эффективно изучить каждый ингредиент и его эффект.Существует много совпадений, но есть и некоторое потенцирование.

DiNubile: Глюкозамин/хондроитин Лечение артрита В испытательном (GAIT) исследовании описан синергизм между глюкозамином и хондроитином. сульфат. В сочетании эти два соединения оказывали более сильное действие, даже хотя окончательное определение не может быть сделано для группы от умеренной до тяжелой из-за недостаточного размера выборки пациентов. 13

В группе, принимавшей глюкозамин/хондроитинсульфат, результаты оказались лучше целекоксиб (Celebrex, Pfizer, Inc.) и группы плацебо для тех, у кого ОА средней и тяжелой степени.

Комбинации глюкозамина, хондроитинсульфата и АСУ были показана работа в многочисленных исследованиях in vitro, особенно в отношении противовоспалительные эффекты. 7-11

Как уже упоминалось, ASU также может иметь более быстрое начало. Из моего опыта, это По-видимому, пациенты, принимающие глюкозамин и хондроитинсульфат с АСУ, могут быстрее почувствуете его действие. Как правило, когда я рекомендую глюкозамин и хондроитин сульфат, я говорю пациентам, что им, возможно, придется подождать от 2 до 3 месяцев. чтобы увидеть полные результаты.Однако в одном исследовании глюкозамина и хондроитина сульфата, участники показали улучшение на 8 недель.

Опубликованное исследование

Bergfeld: Подтверждают ли заявления о продукте какие-либо опубликованные исследования? для нутрицевтиков?

Morton: Фундаментальные научные исследования на животных моделях демонстрируют благотворное влияние нутрицевтиков, в том числе снижение воспалительного медиаторы, такие как оксид азота, а также защита суставов и хрящей.

В постконтузионном исследовании на кроликах сравнивали повреждения суставов у кроликов. леченных АСУ нелеченным кроликам. 14 Результаты исследования показали меньшее повреждение суставов у обработанных кроликов, чем у необработанных. кролики.

В июне 2010 года PubMed перечислил два исследования, которые показали, что хондроитин сульфат уменьшает потерю суставной щели по сравнению с плацебо. 15,16 В ежегодная конференция Европейской лиги против ревматизма (EULAR) в июне 2010 г., Маэ представил исследование под названием Eradias, трехлетнее проспективное слепое исследование влияние АСУ на ОА тазобедренного сустава, что указывало на уменьшение сужения совместное пространство 20% в течение 3 лет. 17

Перспектива
Шерман О.
Канапп-младший

В Группе ветеринарной ортопедии и спортивной медицины (VOSM) работают самые разные пациенты: от домашних животных, принадлежащих клиентам, до рабочих собак и служебных собак. Многие из этих пациентов получают травмы из-за повторяющихся сильных нагрузок на суставы и поддерживающие структуры во время тренировок или выступлений. Как специализированная больница, я вижу много пациентов, у которых были проблемы в течение длительного периода времени и клинические признаки ОА, такие как остеофиты, обширная эрозия гиалинового хряща и/или боль в суставах.

В дополнение к хирургическому ремонту и реабилитационной терапии мы также используем регенеративную медицину, внутрисуставную терапию и добавки для здоровья суставов, такие как Dasuquin (Nutramax Laboratories, Inc.). Dasuquin, который содержит комбинацию глюкозамина, хондроитинсульфата и неомыляемых соединений авокадо-сои (ASU), не только помогает поддерживать поврежденный сустав или конечность, но также помогает поддерживать суставы в других ногах, которые должны компенсировать пораженную конечность. Хотя я обнаружил, что глюкозамин и хондроитинсульфат работают эффективно, комбинация с ASU была долгожданным дополнением из-за более быстрого ответа и повышенной мобильности пациентов.

Одно исследование механизма действия ASU на собаках показало, что ASU оказывает анаболическое действие на выработку хрящевого матрикса, а другое исследование отмечает его защитное действие на суставной хрящ. 1,2 Исследования показывают, что хондроциты человека и животных сходны по своей реакции на глюкозамин, хондроитинсульфат и АСУ.

Исследование in vitro с использованием хондроцитов и других клеток суставов у разных видов продемонстрировало, что комбинация ASU, глюкозамина и хондроитинсульфата ослабляет экспрессию или выработку медиатора воспаления, 3-5 , что помогает защитить от разрушения хряща и повреждения других тканей сустава и улучшает комфорт суставов.Исследования in vitro также показали лучший ответ на три препарата в комбинации, чем на глюкозамин и хондроитинсульфат по отдельности. 3

Каталожные номера:
  1. Алтинел Л., Саритас З.К., Козе К.С. и др. Лечение неомыляемыми экстрактами авокадо и сои повышает уровни TGF-1 и TGF-2 в суставной жидкости собак. Tohoku J Exp Med . 2007; 211:181-186.
  2. Boileau C, Martel-Pelletier J, Caron J, et al.Защитное действие общей фракции неомыляемых соединений авокадо/сои на структурные изменения при экспериментальном остеоартрите собак: ингибирование синтазы оксида азота и матриксной металлопротеиназы-13. Лечение артрита . 2009;11(2):R41.
  3. Au RY, Au AY, Rashmir-Raven A, Frondoza CG. Ингибирование экспрессии провоспалительных генов в хондроцитах, моноцитах и ​​фибробластах комбинацией неомыляемых соединений авокадо, сои, глюкозамина и хондроитинсульфата. FASEB J . 2007;21(6):702-707.
  4. Демко Дж.Л., Фан П.В., Крамер Э.А. и др. Ингибирование продукции простагландина E-2 в культурах хондроцитов-микроносителей за счет комбинации неомыляемых соединений авокадо-сои, хондроитинсульфата и глюкозамина. Представлено на 34-й ежегодной конференции Ветеринарно-ортопедического общества. 2007; 25. Солнечная долина, штат Айдахо; 3-10 марта 2007 г.
  5. Punke JP, Au RY, Au AY и др. Модуляция продукции простагландина Е-2 в кошачьих суставных хондроцитах, размноженных в монослое и культуре динамического микроносителя.Плакат представлен на Ветеринарном симпозиуме ACVS 2007 года. Чикаго.

Шерман О. Канапп-младший, DVM, MS, CCRT, Diplomate ACVS, ACVSMR, является владельцем и руководителем группы ветеринарной ортопедии и спортивной медицины в Аннаполис-Джанкшен, штат Мэриленд.

McDevitt: Как и многие пациенты, я скептически отнесся к приему глюкозамина. и хондроитинсульфат впервые появился на рынке. Хотя я просмотрел Европейские и ветеринарные исследования, наиболее эффективные данные для меня получены из личный опыт.

Мой 12-летний золотистый ретривер с трудом ходил. когда я взял ее к ветеринару, врач порекомендовал глюкозамин и хондроитин сульфат.

Я сказал: «Глюкозамин и хондроитинсульфат? Это просто плацебо эффекта», на что доктор ответил: «Собаки не знают плацебо». эффект. Попытайся.”

Через шесть недель моя собака снова побежала. После этого я начал принимать свое лекарство, потому что подумал, что оно может помочь и такой старой собаке, как я.

Бергфельд: Нет никаких сомнений в том, что ветеринарная медицина провели полезные исследования, которые показали, как использование глюкозамина и хондроитина сульфат улучшает хромоту у лошадей. Ветеринарная литература сильна и, возможно, его следует больше учитывать в нашей собственной практике.

Какие доступны данные, которые отмечают влияние ASU на OA?

Мортон: Недавнее исследование Павелки и ее коллег 18 показали, что доза 300 мг ASU и доза 1200 мг хондроитинсульфата добились аналогичных улучшений как в индексах WOMAC, так и в индексах Lequesne.

Moorman: Добавление АСУ к глюкозамину и хондроитину сульфат является захватывающим, потому что пациенты, как правило, быстрее реагируют на это комбинация. Я сам принимал эти продукты, и мой опыт подтверждает это наблюдение.

Как упомянул д-р Мортон, более поздние исследования показывают, что мы приближаются к нестероидной эффективности с ASU. Я не думаю, что мы могли бы сказали это только о глюкозамине и хондроитине.

DiNubile: Многие оригинальные исследования в области ревматологии В литературе показана эффективность глюкозамина и хондроитинсульфата. в руке. 19,20

Исследование ПОХОДКИ

Bergfeld: Исследование GAIT, опубликованное в 2006 г., показало, что глюкозамин и хондроитинсульфат в комбинации или по отдельности не уменьшали обезболивание эффективно в общей исследуемой группе с ОА коленного сустава. 13 Эти выводы были поддержаны AAOS, которая не рекомендует использовать нутрицевтики при ОА.

Как вы относитесь к результатам этого исследования и его последствиям? для использования глюкозамина и хондроитинсульфата в вашей практике?

Schenck: Я думаю, что исследование GAIT дало достоверные рандомизированное исследование, в котором изучались глюкозамин и хондроитинсульфат. Больше исследований такие как это, которые сосредоточены на рандомизированных слепых испытаниях с глюкозамином и хондроитина сульфата, необходимо выполнить.

Исследование GAIT устранило многие проблемы, отмеченные в предыдущих исследованиях. исследования, т. е. исследования, которые поддерживались промышленностью, неслепые или нерандомизированный.Возможно, это не дало результатов, которые клиницисты, использующие Нутрицевтики хотели, но очевидно, что это было хорошо проведенное рандомизированное исследование.

Макдевитт: Меня беспокоит, насколько достоверны результаты GAIT связано с тем, что очень многие участники принимали ацетаминофен в одновременно с глюкозамином и хондроитинсульфатом. Я задаюсь вопросом, является ли результатом этого был высокий эффект плацебо. Для меня результаты исследования было бы более надежным, если бы участникам давали только глюкозамин и сульфат хондроитина.

«Добавление АСУ к глюкозамину и хондроитину сульфат является захватывающим, потому что пациенты, как правило, быстрее реагируют на это комбинация».
– Клод Т. Мурман III, доктор медицины

Мортон: Я также подвергаю сомнению выраженный эффект плацебо, описанный в исследование ПОХОДКИ. Доля плацебо в 60% сомнительна, потому что процент обычно 25% или 30% в исследовании обезболивания.Из-за этого и другого исследований, подтверждающих преимущества его использования, я все еще прописываю глюкозамин и хондроитинсульфат, несмотря на результаты исследования GAIT.

DiNubile: Исследование GAIT вызвало больше вопросов, чем дало ответы. Группа исследования от умеренной до тяжелой хорошо себя чувствовала с добавками; однако в этой группе было недостаточно участников, чтобы достичь Статистическая значимость. Даже исследователи, участвовавшие в исследовании GAIT пришел к выводу, что необходимо провести дополнительные исследования.

Поэтому я был разочарован, увидев, что AAOS основывало свое решение не рекомендовать глюкозамин и хондроитинсульфат исключительно в рамках данного исследования. я считают, что эти руководящие принципы необходимо пересмотреть, а не только пересмотреть глюкозамин и хондроитин сульфат, но также рассмотреть возможность комбинации с ASU и обеспечить лучшую оценку литературы по добавкам, улучшающим вязкость.

Несмотря на текущие рекомендации AAOS, я буду продолжать рекомендовать глюкозамин и хондроитин сульфат моим пациентам.Я основываю это решение на очень благоприятный профиль безопасности этих соединений, а также богатство литература — человек, ветеринария, in vitro и in vivo — доступен на данный момент. Понятно, что пациенты более неохотно используют НПВП, особенно на хронической основе. Совместные добавки помогли заполнить эту пустоту в моя практика.

Постановление

Бергфельд: Каковы действующие стандарты регулирования для нутрицевтики в Соединенных Штатах?

McDevitt: Закон о пищевых добавках, здравоохранении и образовании (DSHEA), что позволяет пациентам получать пищевые добавки без предписание было принято в 1994 г.Согласно DSHEA, пищевая добавка является широко определяется как любой нетабачный продукт, «предназначенный для дополнения диета», включая витамины, минералы, травы или другие растительные вещества, аминокислоты, пищевое вещество, предназначенное для употребления человеком в качестве дополнения к рациону путем увеличения общее потребление с пищей или концентрат, метаболит, составляющая, экстракт или комбинация любого из предыдущих веществ. 21

Этот закон активно лоббировался индустрией пищевых добавок, и после его принятия количество пищевых добавок, продаваемых в США, резко возросло.В В 2009 году было подсчитано, что 59% американцев придерживались диетического питания. добавка. 22 Департамент DSHEA утверждает, что добавка — это то, что используется для дополнения вашего рациона, т. е. минерал, трава или аминокислота, но не указанный как пищевых продуктов и предназначен для использования в виде пилюль, капсул, таблеток или жидкость. 21

Однако Конгресс решил исключить пищевые добавки из определение пищевой добавки. Поэтому пищевые добавки регулируются, как продукт питания или лекарство, основываясь на их заявлениях на этикетке, хотя есть исключения для БАДы от обычных правил маркировки. 21 Это сделало существенная разница в том, что компания может производить и как дополняет были просмотрены и обработаны в Соединенных Штатах.

До DSHEA нутрицевтики, такие как глюкозамин или хондроитин сульфат подошел бы под правила FDA. Теперь о включении заявление «Эти заявления не были оценены FDA, и это продукт не предназначен для диагностики, лечения, излечения или предотвращения каких-либо заболеваний». требуется на этикетках пищевых добавок.Из-за этого компании запрещено делать заявления о продуктах относительно их влияния на заболевание процесс, т. е. они могут указывать на то, что продукт может снизить риск болезнь, но они не могут сказать, что она на самом деле лечит болезнь.

Bergfeld: Как пациенты могут быть уверены, что продукт соответствует этикетке? претензии при покупке нутрицевтиков, таких как глюкозамин и хондроитин сульфат с ВРУ?

«Загрязнение является серьезной проблемой для добавки…Это затронуло многих потребителей, особенно спортсмены».
– Эдвард Р. Макдевитт, MD

McDevitt: Управление по санитарному надзору за качеством пищевых продуктов и медикаментов (FDA) опубликовало Правила надлежащей производственной практики (GMP), правила нутрицевтики, определяющие маркировку, должны указывать дозировка продукта, инструкции по применению и информация производителя. GMP также требует согласованных производственных процессов, например, чистота, сила и состав, для пищевых добавок.

Загрязнение является серьезной проблемой пищевых добавок, поскольку некоторые компании будет запускать несколько продуктов на одной сборочной линии без очистки техника. 23 Это затронуло многих потребителей, особенно спортсменов, которые использовали продукт, загрязненный анаболическими стероидами, от другого продукт, в результате чего они дали положительный результат во время тестирования на наркотики. Следовательно, зная какие нутрицевтики эффективно регулируются важно для врачей лечения спортсменов, которые ожидают, что их поставщики медицинских услуг будут знать, какие добавки одобрены Всемирной антидопинговой ассоциацией.

FDA проводит инспекции контроля качества в компаниях. объектов, но из-за бюджетных сокращений регулярные проверки, как правило, проводится на крупных производственных предприятиях. Федеральная торговая комиссия является несет ответственность за расследование потенциальных несправедливых или вводящих в заблуждение практик, которые воздействовать на потребителей.

DiNubile: Эти продукты также соответствуют заявленным на этикетке, в то время как биоактивность используемого соединения сильно различается по сравнению с другие продукты.

Например, продукт может содержать количество глюкозамина или хондроитин, указанный на этикетке, но производитель мог использовать смесь пяти различных типов глюкозамина или хондроитина, некоторые из которых очень биоактивны, а некоторые из них вообще не биоактивны. Следовательно, нет Независимо от того, насколько информирован потребитель или врач о продукте, они невозможно получить эту информацию с этикетки.

Cosamin DS (Nutramax Laboratories, Inc.), оригинальный глюкозамин и комбинация хондроитинсульфата всегда производилась в соответствии с фармацевтические стандарты GMP. Это не всегда так, потому что некоторые компании используют более низкое качество или значительно меньшую дозировку из-за Стоимость хондроитина. Независимые исследования показали огромные различия в фактическое содержание хондроитинсульфата в различных продуктах, многие из которых не соответствовать заявленному заявлению на этикетке. 24

Bergfeld: Как пациент может определить, какие нутрицевтики соответствуют претензии к этикетке?

DiNubile: Текущий Ю.S. законы и правила не требуют добавки для удовлетворения заявлений на этикетке. Таким образом, на этикетке может быть указано, что ее продукт содержит 1200 мг хондроитинсульфата, хотя на самом деле его меньше. Чтобы помочь пациентам определить, какие нутрицевтики соответствуют заявленным на этикетке, я предоставляю предоставьте им печатные материалы и предложите им онлайн-ресурсы для посещения.

Примеры этих онлайн-ресурсов включают www.consumerlabs.com, который независимо тестирует различные бренды, чтобы увидеть, соответствуют ли они этикетке претензии и www.NSF.org, который не только тестирует и сертифицирует бренды, но и проверяет наличие нежелательных загрязнений и добавки.

Morton: Также могут быть расхождения между общими лекарства указывают на их этикетках и то, что продукты действительно содержат. По данным FDA, дженерику уровня А нужны ингредиенты, содержащиеся в его продукте. быть в пределах 20% от того, что заявлено на этикетке. Это было бы похоже на обычная долларовая купюра стоимостью от 0 долларов.80 и 1,20 доллара.

Bergfeld: Какие ресурсы мы можем предоставить пациентам, чтобы убедить их стандартов продукта для контроля качества?

Dugas: К сожалению, у потребителей нет идеального способа проверьте содержание любых добавок или нутрицевтиков. Консультируя пациентов, Я призываю их использовать продукты, произведенные известными отечественными компаниями. я также поощряйте их исследовать предлагаемую пользу от любых добавок и рекомендую www.NSF.org, если пациент желает получить дополнительную информацию.

McDevitt: NSF Certified for Sport, также регулируется www.NSF.org, тестирует и сертифицирует что продукты содержат заявленные идентичность и количество диетических ингредиентов на этикетке продукта и что они не содержат недопустимых количеств нежелательные примеси для рекомендуемого размера порции, указанного на продукте этикетка.

«Многие врачи и фармацевты могут порекомендовать купить самые дешевые [добавки], потому что они все одинаковые, но нет ничего дальше от истины.
— Николас Динубиле, доктор медицины

DiNubile: Нутрицевтики оцениваются NSF; Однако, оценка продукта является добровольной, поэтому компании-производители пищевых добавок не обязаны участвовать. Программа NSF Certified for Sport важна для спортсменов. Когда добавка сертифицирована для спорта, это означает, что количественный анализ было проведено, чтобы определить, соответствует ли добавка заявленным на этикетке требованиям. Это также гарантирует отсутствие дополнительных добавок или загрязнений, в том числе запрещенных веществ, что может привести к дисквалификации, наказаниям, штрафам, приостановки или даже судебные иски для спортсменов.

Когда у меня есть пациенты, принимающие добавки, я объясняю, что марка, которую они выбор имеет важное значение, поскольку данные показывают, что значительное число компаний не соответствуют заявленным на этикетке. Многие врачи и фармацевты могли бы сказать, чтобы купить самый дешевый, потому что они все одинаковые, но нет ничего кроме правда. Поэтому я обычно рекомендую Cosamin DS и Cosamin ASU. (Nutramax Laboratories, Inc.) из-за их приверженности исследованиям в поле.

Dugas: Что касается спортсменов, которым мы оказываем помощь, я хотелось бы привлечь к обсуждению диетолога. В частности, в более теплый южный климат, в котором я живу, питание и увлажнение имеют первостепенное значение важность. Любая добавка, которую спортсмен хочет использовать, должна быть тщательно продумана. рассматривается под эгидой их общего питания.

Bergfeld: Есть ли разница в том, как нутрицевтики регулируется в Европе?

McDevitt: Пищевые добавки в Европе гораздо более контролируемы, чем они находятся в Соединенных Штатах, поэтому то, что здесь может быть немедикаментозным, может быть рецепт из Европы.

Будущие рекомендации

Бергфельд: Какими, по вашему мнению, будут рекомендации на будущее? полезно для нутрицевтической промышленности?

Morton: Другие исследования, посвященные нутрицевтикам и их потенциальные преимущества регенерации хряща должны быть проведены. реестр, а сбор данных в реальном мире, может быть рассмотрен для врачей, которые рекомендуют нутрицевтики своим пациентам. Он может охватывать демографические данные пациентов, которые лечатся заболевания, какое лечение рекомендуется, продолжительность терапии и некоторых результатов, таких как функциональный индекс или шкала боли.Данные реестра распространены в Европе и медленно развиваются в Соединенных Штатах. Состояния. Это позволяет обследовать большое количество пациентов без строгой приверженность клиническим испытаниям.

Бергфельд: Данные, которые можно получить из реестра, будут чрезвычайно выгодно; однако создание такой базы данных является трудоемким и дорого, и необходимо выполнять значительное обслуживание, чтобы гарантировать, что данные точный. Я думаю, что инвестиции в такую ​​систему оправданы, и польза для врачей будет бесценным.

McDevitt: Одна из самых захватывающих областей исследований в ортопедия включает биологические препараты, такие как различные факторы роста. Например, факторы роста богатой тромбоцитами плазмы могут помочь пациентам с заболеваниями опорно-двигательного аппарата. Проводятся дальнейшие исследования белков, которые может быть в состоянии обратить вспять последствия артрита суставов. Хотя непонятно какие открытия станут результатом этого исследования, я уверен, что захватывающие новые информация скоро будет.

Morton: Исследование стволовых клеток — еще одно интересное событие в области ортопедии. Вскоре в Англии начнется исследование, где стволовые клетки будет использоваться для попытки регенерировать поврежденный хрящ для лечения или даже предотвратить ОА. 25 Биомаркеры важны для мониторинга прогрессирования болезни. Также обсуждалось использование акустических методов. прослушивать суставы для диагностики патологии. 26

DiNubile: Хотя технология МРТ отлично подходит для визуализации менисков, связок и даже стрессовых переломов, до настоящего времени не было так эффективен при оценке суставного хряща.Новые системы количественной МРТ которые развиваются, но еще не получили широкого распространения, также могут быть полезными потому что они могут количественно раскрасить суставной хрящ. Как только это технологии развиваются дальше, мы можем получить более четкое представление как работают нутрицевтики, как быстро они действуют и могут ли они помочь восстанавливают хрящевые дефекты или стимулируют отрастание хряща.

Мортон: Недавнее исследование, представленное Пеллетье и его коллегами в Конгресс EULAR 2010 использовал МРТ для оценки эффектов хондроитинсульфата. как DMOAD на объем хряща, поражения костного мозга и синовит. 27 Их результаты показали, что хондроитин сульфат предотвращает потерю объем хряща всего за 6 месяцев, а поражение костного мозга было пострадавших от 6 до 12 месяцев. Исследование также показало, что сочетание НПВП с хондроитинсульфатом уменьшали выраженность синовита.

DiNubile: Достижения в нашей области будут достигнуты не только технологиями, но и ортопедами, обучающими себя и своих пациентов о потенциальных преимуществах нутрицевтиков и других натуральных Средства.В настоящее время значительное число наших пациентов принимают нутрицевтики, вне зависимости от того, каковы современные рекомендации по их употреблению. может быть. Поэтому, чтобы наилучшим образом лечить наших пациентов, мы обязаны узнать больше об этом потенциальном варианте лечения, чтобы мы могли помочь им в принятие обоснованных решений о нутрицевтиках и других менее инвазивных подходы, независимо от наших предпочтений в лечении.

Наши пациенты проявляют большой интерес к альтернативной медицине, а также в более естественных подходах, поэтому нам нужно сохранять непредвзятость, поскольку научные данные продолжают накапливаться в этой относительно новой области.В конечном счете, мы должны полагаться на наука для руководства рекомендациями по лечению.

«Продолжение исследований в области нутрицевтиков и добавки будут важной частью улучшения физической формы, долголетия и лечение и профилактика заболеваний по мере продвижения вперед».
– Джеффри Р. Дугас, MD

Дуга: Как обсуждалось ранее, мы находимся в эпицентре взрыва. знаний в области здоровья и фитнеса.Наше общество знает, что они должны питаться разумно и заниматься спортом как часть здорового образа жизни. часть нашего здоровый образ жизни заключается в том, чтобы наши диеты были сбалансированы с достаточным количеством питательные вещества для поддержки изменяющихся потребностей нашего организма. Возраст, травмы, болезни, Окружающая среда и генетика влияют на потребности нашего тела. Продолжение исследований в области нутрицевтиков и добавок станет важной частью улучшение физической формы, долголетие, лечение и профилактика заболеваний во время движения вперед.

Заключение

Бергфельд: Я хотел бы поблагодарить комиссию за потраченное время и усилия и экспертные знания по вопросу нутрицевтических вариантов в контексте ортопедия и спортивная медицина и спонсор этого симпозиума, Nutramax Laboratories, Inc. Информация, предоставленная в ходе этого обсуждения способствует большей глубине знаний о различных вариантах лечения доступны для ОА, как с клинической точки зрения, так и с точки зрения спортивной медицины.Благодаря тщательному изучению литературы и непосредственному практическому опыту, общее медицинское сообщество становится более осведомленным и более готовым рассмотреть доступные варианты ОА.

Каталожные номера
  1. ЦКЗ. Распространенность диагностированного врачом артрита и связанное с артритом ограничение активности — США, 2007–2009 гг. МВВР . 2010;59(39):1261-1265.
  2. ААОС. США Десятилетие костей и суставов: бремя Заболевания опорно-двигательного аппарата в США .Роузмонт, Иллинойс: американец Академия хирургов-ортопедов; 2008.
  3. Moseley JB, O’Malley K, Petersen NJ, et al. Контролируемое испытание артроскопической хирургии при артрозе коленного сустава. N Англ J Мед . 2002;347(2):81-88.
  4. ДиНубиле Н.А. Потенциальная роль авокадо и соевых бобов пищевые добавки в лечении остеоартрита — обзор. Врач и спортивная медицина . 2010;38(2):71-81.
  5. Appelboum T, Schuemans J, Verbruggen G, et al. Симптомы модификации Влияние неомыляемых соединений авокадо/сои (ASU) на остеоартрит коленного сустава. А двойное слепое проспективное плацебо-контролируемое исследование. Сканд Дж Ревматол . 2001;304(4):242-247.
  6. Дас А младший, Хаммад Т.А. Эффективность комбинации глюкозамина FCHG49 гидрохлорид, TRh222 низкомолекулярный хондроитинсульфат натрия и аскорбат марганца в лечении остеоартрита коленного сустава. Остеоартрит Хрящ . 2000;8(5):343-350.
  7. Au RY, Au AY, Snow GE, Rashmir-Raven A, Frondoza CG. Циклооксигеназа-2 экспрессия генов и продукция простагландина-Е2 в активированных остеобластах лошадей ингибируются неомыляемыми соединениями авокадо, сои, глюкозамином и хондроитином сульфат [аннотация]. Представлено в Американском ветеринарном колледже в 2007 г. Труды форума по внутренней медицине (ACVIM). Солнечная долина, штат Айдахо; 3-10 марта 2007 г.
  8. Au AY, Au RY, Rashmir-Raven AM, Frondoza CG. Понижение экспрессия циклооксигеназы-2 и продукция простагландина-Е2 у лошадей хондроциты и остеобласты неомыляемыми соединениями авокадо, сои, глюкозамином, и хондроитин сульфат. Proc Equine Sci Soc . 2007.
  9. Au RY, Au AY, Rashmir-Raven A, Frondoza CG. Ингибирование экспрессия провоспалительных генов в хондроцитах, моноцитах и ​​фибробластах комбинация неомыляемых соединений авокадо, сои, глюкозамина и сульфат хондроитина. FASEB J . 2007;21(6):702-707.
  10. Au RY, Au AY, Rashmir-Raven AM, Frondoza CG. Провоспалительный ген экспрессия в хондроцитах и ​​моноцитах/макрофагах ингибируется комбинация неомыляемых соединений авокадо, сои, глюкозамина и хондроитина сульфат [аннотация]. Представлено на 34-й ежегодной ветеринарной конференции Ортопедическое общество. 2007. Чикаго.
  11. Фрондоза CG, Heinecke LF, Grzanna MW, Au AY, Rashmir-Raven AM.Модуляция экспрессии металлопротеиназ комбинацией авокадо-сои неомыляемые вещества, глюкозамина гидрохлорид и хондроитинсульфат. Представлено на 8-м Всемирном конгрессе Международного общества восстановления хрящей. Майами, Флорида: 23-26 мая 2009 г.
  12. Бруйер О., Павелка К., Ровати Л.С. и др. Полная замена сустава после Лечение сульфатом глюкозамина остеоартрита коленного сустава: результаты среднего 8-летнего исследования наблюдение за пациентами из двух предшествующих 3-х лет, рандомизированное, плацебо-контролируемые испытания. Остеоартрит Хрящ . 2008;16(2):254-260.
  13. Клегг Д.О., Реда Д.Дж., Харрис С.Л. и др. Глюкозамин хондроитин сульфат и два в комбинации при болезненном остеоартрите коленного сустава. с.ш. англ J Med . 2006;354(8):795-808.
  14. Мазьер Б., Темпеста С., Тишар М., Вагье Г. Патологический и биохимические эффекты липидного экстракта авокадо и сои на экспериментальный постконтузионная модель ОА [аннотация]. Остеоартрит Хрящ . 1993; 1:46.
  15. Кахан А., Убельхарт Д., Де Ватер Ф. и др. Долгосрочные эффекты хондроитин 4 и 6 сульфат при остеоартрозе коленного сустава: исследование профилактика прогрессирования остеоартроза, двухлетняя, рандомизированная, двойная слепая, плацебо-контролируемое исследование. Ревматоидный артрит . 2009;60(2):524-533.
  16. Блэк С., Клар С., Хендерсон Р. и др. Клиническая эффективность добавки с глюкозамином и хондроитином для замедления или остановки прогрессирования остеоартроз коленного сустава: систематический обзор и экономическая оценка. Оценка медицинских технологий . 2009;(52):1-148.
  17. Маэ Э., Кадет С., Марти М. и др. Оценка структурно-модифицирующее действие авокадо-соевых неомыляемых соединений (АСУ) на тазобедренный сустав остеоартроз (ОА): результаты исследования Eradias — 3-летняя перспектива, рандомизированное двойное слепое плацебо-контролируемое исследование . Представлено на 2010 Ежегодный Европейский конгресс ревматологов. Рим, Италия; 16-19 июня 2010 г.
  18. Павелка К., Косте П., Гехер П. и др.Эффективность и безопасность пиаскледин 300 по сравнению с хондроитин сульфатом в течение 6 месяцев лечения плюс 2 месяцев наблюдения за больными остеоартрозом коленных суставов. Клин Ревматол . 2010;29(6): 659-670.
  19. Uebelhart D. Клинический обзор хондроитинсульфата в остеоартрит. Остеоартрит Хрящ . 2008;16:С19-С21.
  20. Verbruggen G, Goemaere S, Veys EM. Системы для оценки прогрессирования остеоартрита суставов пальцев и влияния модификации заболевания препараты от остеоартрита. Клин Ревматол . 2002; 21:231-243.
  21. ДШЭА. 21 USC §321(ff) [DSHEA §3(a)].1994.
  22. Национальная ассоциация здоровья. Изучение отношения потребителей к исследование барометра пищевых добавок. Доступны на: http://nationalwellnessassociation.com/News/Survey_Results.htm. По состоянию на 8 октября 2010 г.
  23. Опасные добавки. Отчеты о потреблении . 2010:16-23.
  24. Адебовале А., Кокс Д., Лян З. и др.Анализ глюкозамина и содержание хондроитинсульфата в продаваемых продуктах и ​​проницаемость Caco-2 хондроитин сульфат сырья. J Amer Nutraceutical Assoc . 2000;3(1):37-44.
  25. Ученые проводят новое исследование стволовых клеток, которое может предотвратить остеоартрит. Артрит сегодня [сериал онлайн]. 2010;148:10. Доступны на: http://www.arthritisresearchuk.org/PDF/ArthritisToday%20SMALL.pdf. По состоянию на 30 августа 2010 г.
  26. Kwong KSC, Huang X, Cheng JCY и др. Акустическая передача в норме бедра человека: структурное тестирование симметрии суставов. Медицинская физика . 2003;25(10): 811-816.
  27. Pelletier JP, Wildi LM, Raynauld JP, et al. Лечение с помощью хондроитинсульфат уменьшает потерю объема хряща у пациентов с остеоартрозом коленного сустава с помощью МРТ: рандомизированное двойное слепое плацебо-контролируемое пилотное исследование 91,197 . Плакат представлен на конгрессе EULAR 2010.Рим, Италия: 16–19 июня 2010 г.

ДОБАВИТЬ ТЕМУ В СООБЩЕНИЯ ПО ЭЛЕКТРОННОЙ ПОЧТЕ

Получать электронные письма, когда новые статьи публикуются на

Пожалуйста, укажите свой адрес электронной почты, чтобы получать электронные письма, когда новые статьи публикуются на . Подписаться Нам не удалось обработать ваш запрос.Пожалуйста, попробуйте позже. Если у вас по-прежнему возникает эта проблема, свяжитесь с нами по адресу [email protected]

Назад к Хелио

Использование, побочные эффекты, доза, польза для здоровья, меры предосторожности и предупреждения

[Благотворное влияние Chondrosulf 400 на боль и суставную функцию при артрозе: метаанализ]. Presse Med 2000;29(27 Suppl):19-20. Посмотреть реферат.

[Европейское многоцентровое исследование эффективности хондроитинсульфата при гонартрозе: новый взгляд на биохимические и рентгенологические результаты].Presse Med 2000;29(27 Suppl):15-18. Посмотреть реферат.

Adebowale AO, Cox DS Liang Z Eddington ND. Анализ содержания глюкозамина и хондроитинсульфата в продаваемых продуктах и ​​проницаемости caco-2 сырья для хондроитинсульфата. J Am Nutraceutical Assoc. 2000;3:37-44.

Алексеева Л. И., Беневоленская Л. И., Насонов Е. Л., Чичасова Н. В., Карякин А. Н. Структум (хондроитин сульфат) – новое средство для лечения остеоартроза. Тер.Арх. 1999;71(5):51-53.Посмотреть реферат.

Бана Г., Жамар Б., Верруил Э. и Мазьер Б. Хондроитинсульфат при лечении остеоартрита тазобедренного и коленного суставов: обзор. Adv.Pharmacol. 2006;53:507-522. Посмотреть реферат.

Bhattacharyya, S., Solakyildirim, K., Zhang, Z., Chen, ML, Linhardt, RJ, and Tobacman, JK. Связанный с клетками IL-8 увеличивается в бронхиальных эпителиальных клетках после подавления арилсульфатазы B из-за секвестрации хондроитин- 4-сульфат. Am.J.Respir.Cell Mol.Biol. 2010;42(1):51-61.Посмотреть реферат.

Блэк К., Клар К., Хендерсон Р., Макихерн К., Макнами П., Куайюм З., Ройл П. и Томас С. Клиническая эффективность добавок глюкозамина и хондроитина в замедлении или остановке прогрессирования остеоартрита коленного сустава: систематический обзор и экономическая оценка. Health Technol.Assess. 2009;13(52):1-148. Посмотреть реферат.

Блотман Ф. и Лояу Г. Клинические испытания хондроитинсульфата при гонартрозе [аннотация]. Корзина остеоартрита 1993; 1:68.

Браун, В. А., Флинн, М. Г., Армстронг, В. Дж., и Джекс, Д. Д. Влияние добавок хондроитинсульфата на показатели мышечного повреждения, вызванного эксцентрическими упражнениями на руки. J.Sports Med.Phys.Fitness 2005;45(4):553-560. Посмотреть реферат.

Bruyere, O., Burlet, N., Delmas, P.D., Rizzoli, R., Cooper, C. и Reginster, JY. Оценка симптоматических медленно действующих препаратов при остеоартрите с использованием системы GRADE. BMC.Опорно-двигательный аппарат.Расстройство. 2008; 9:165. Посмотреть реферат.

Червиньи, М., Натале Ф., Наста Л., Падоа А., Вои Р.Л. и Порру Д. Комбинированная внутрипузырная терапия гиалуроновой кислотой и хондроитином при рефрактерном синдроме болезненного мочевого пузыря/интерстициальном цистите. Int.Urogynecol.J.Telvic.Floor.Dysfunct. 2008;19(7):943-947. Посмотреть реферат.

Chen, W.C., Yao, C.L., Chu, I.M., и Wei, Y.H. Сравните эффекты хондрогенеза культурой мезенхимальных стволовых клеток человека с различными типами хондроитинсульфата C. J.Biosci.Bioeng. 2011;111(2):226-231.Посмотреть реферат.

Конте А., де Бернарди М., Пальмьери Л., Луальди П., Маутоне Г. и Ронка Г. Метаболическая судьба экзогенного хондроитинсульфата у человека. Арцнаймиттельфоршунг. 1991;41(7):768-772. Посмотреть реферат.

Кроули, Д.К., Лау, Ф.К., Шарма, П., Эванс, М., Гатри, Н., Багчи, М., Багчи, Д., Дей, Д.К., и Райчаудхури, С.П. Безопасность и эффективность неденатурированных препаратов типа II Коллаген в лечении остеоартрита коленного сустава: клиническое исследование. Int.J.Med.Sci. 2009;6(6):312-321.Посмотреть реферат.

Damiano, R., Quarto, G., Bava, I., Ucciero, G., De, Domenico R., Palumbo, MI, и Autorino, R. Профилактика рецидивирующих инфекций мочевыводящих путей путем внутрипузырного введения гиалуроновой кислоты и хондроитинсульфат: плацебо-контролируемое рандомизированное исследование. Евро.Урол. 2011;59(4):645-651. Посмотреть реферат.

David-Raoudi, M., Deschrevel, B., Leclercq, S., Galera, P., Boumediene, K., and Pujol, JP. стр. 38 и Акт.Ревмирующий артрит. 2009;60(3):760-770. Посмотреть реферат.

Де, Вита Д. и Джордано, С. Эффективность внутрипузырного введения гиалуроновой кислоты/хондроитинсульфата при рецидивирующем бактериальном цистите: рандомизированное исследование. Int.Urogynecol.J. 2012;23(12):1707-1713. Посмотреть реферат.

du Souich, P., Garcia, A.G., Verges, J., and Montell, E. Иммуномодулирующее и противовоспалительное действие хондроитинсульфата. J.Cell Mol.Med. 2009;13(8А):1451-1463. Посмотреть реферат.

Дудич В., Кунстар А., Ковач Дж., Лакатос Т., Гехер П., Гомор Б., Моностори Э. и Угер Ф. Хондрогенный потенциал мезенхимальных стволовых клеток пациентов с ревматоидным артритом и остеоартритом: измерения в системе микрокультур . Клетки Ткани. Органы 2009;189(5):307-316. Посмотреть реферат.

Эджеа Дж., Гарсия А.Г., Вергес Дж., Монтелл Э. и Лопес М.Г. Антиоксидантное, противовоспалительное и нейропротекторное действие хондроитинсульфата и протеогликанов. Остеоартрит. Хрящ. 2010;18 Приложение 1:S24-S27.Посмотреть реферат.

Эмбриано, П. Дж. Послеоперационное давление после факоэмульсификации: гиалуронат натрия против хондроитинсульфата натрия-гиалуроната натрия. Энн.Офтальмол. 1989;21(3):85-88, 90. Посмотреть реферат.

Флейш, А.М., Мерлин С., Имхофф А. и др. Годичное рандомизированное двойное слепое плацебо-контролируемое исследование перорального применения хондроитинсульфата у пациентов с остеоартритом коленного сустава. Остеоартрит и хрящи 1997; 5:70.

Фосанг, А. Дж. и Литтл, С. Б. Понимание лекарств: аггреканазы как терапевтические мишени при остеоартрите.Nat.Clin.Pract.Rheumatol. 2008;4(8):420-427. Посмотреть реферат.

Fthenou, E., Zong, F., Zafiropoulos, A., Dobra, K., Hjerpe, A., and Tzanakakis, G. N. Хондроитинсульфат A регулирует адгезию, подвижность и миграцию клеток фибросаркомы через сигнальные пути JNK и тирозинкиназы. In Vivo 2009;23(1):69-76. Посмотреть реферат.

Furer, V., Wieczorek, R.L., и Pillinger, MH. Двусторонний хондрит ушной раковины, которому предшествует введение добавки глюкозамина и хондроитина. Scand.J.Rheumatol.2011;40(3):241-243. Посмотреть реферат.

Хаузер, П. Дж., Буете, Д. А., Калифано, Дж., Софиновски, Т. М., Калкин, Д. Дж., и Херст, Р. Э. Восстановление барьерной функции мочевого пузыря, поврежденного кислотой, путем внутрипузырного введения хондроитинсульфата. Дж.Урол. 2009;182(5):2477-2482. Посмотреть реферат.

Hochberg, M.C. Структурно-модифицирующие эффекты хондроитинсульфата при остеоартрите коленного сустава: обновленный метаанализ рандомизированных плацебо-контролируемых исследований продолжительностью 2 года. Остеоартрит. Хрящ. 2010;18 Приложение 1:S28-S31.Посмотреть реферат.

Хохберг М.С., Жан М. и Лангенберг П. Скорость уменьшения ширины суставной щели у пациентов с остеоартритом коленного сустава: систематический обзор и метаанализ рандомизированных плацебо-контролируемых исследований хондроитинсульфата. Карр.мед.рес.отзыв. 2008;24(11):3029-3035. Посмотреть реферат.

Im, A.R., Park, Y., and Kim, Y.S. Выделение и характеристика хондроитинсульфатов из осетровых рыб (Acipenser sinensis) и их влияние на рост фибробластов.Биол.Фарм.Бык. 2010;33(8):1268-1273. Посмотреть реферат.

Имада К., Ока Х., Кавасаки Д., Миура Н., Сато Т. и Ито А. Противоартритные механизмы действия природного хондроитинсульфата в суставных хондроцитах и ​​синовиальных фибробластах человека. Биол.Фарм Бык. 2010;33(3):410-414. Посмотреть реферат.

Kahan, A., Uebelhart, D., De, Vathaire F., Delmas, PD, and Reginster, JY. Долгосрочные эффекты хондроитинов 4 и 6 сульфата на остеоартрит коленного сустава: исследование предотвращения прогрессирования остеоартрита, двухэтапное исследование. год, рандомизированное, двойное слепое, плацебо-контролируемое исследование.Ревмирующий артрит. 2009;60(2):524-533. Посмотреть реферат.

Канзаки Н., Сайто К., Маэда А., Китагава Ю., Кисо Ю., Ватанабэ К., Томонага А., Нагаока И. и Ямагути Х. Влияние пищевая добавка, содержащая гидрохлорид глюкозамина, хондроитинсульфат и гликозиды кверцетина при симптоматическом остеоартрите коленного сустава: рандомизированное двойное слепое плацебо-контролируемое исследование. J.Sci.Food Agric. 3-15-2012;92(4):862-869. Посмотреть реферат.

Като Д., Эра С., Ватанабэ И., Арихара М., Sugiura, N., Kimata, K., Suzuki, Y., Morita, K., Hidari, K.I., и Suzuki, T. Противовирусная активность хондроитинсульфата E, направленная на белок оболочки вируса денге. Противовирусный рез. 2010;88(2):236-243. Посмотреть реферат.

Кубо М., Андо К., Мимура Т., Мацусуэ Ю. и Мори К. Хондроитинсульфат для лечения остеоартрита тазобедренного и коленного суставов: текущее состояние и будущие тенденции. Жизнь наук. 9-23-2009;85(13-14):477-483. Посмотреть реферат.

Л’Хирондель JL. [Клиническое двойное слепое исследование перорального применения хондроитинсульфата по сравнению сплацебо для лечения большеберцово-бедренного гонартроза у 125 пациентов]. Litera Rheumatologica 1992;14:77-84.

Лейн, С. С., Нейлор, Д. В., Куллерстранд, Л. Дж., Кнаут, К., и Линдстром, Р. Л. Перспективное сравнение эффектов Оккукоат, Вискоат и Хелон на внутриглазное давление и потерю эндотелиальных клеток. J Катаракта Refract.Surg. 1991;17(1):21-26. Посмотреть реферат.

Ларош Л., Аррата М., Брассер Г., Лагутт Ф., Ле Мер Ю., Лумброзо П., Мерканте М., Норманд Ф., Ригал Д., Рончин С. и . [Лечение синдрома сухого глаза слезным гелем: рандомизированное многоцентровое исследование]. J Fr.Ophtalmol. 1991;14(5):321-326. Посмотреть реферат.

Liesegang, T. J. Вязкоупругие вещества в офтальмологии. Surv.Ophthalmol. 1990;34(4):268-293. Посмотреть реферат.

Mathieu, P. [Рентгенологическое прогрессирование внутреннего бедренно-большеберцового остеоартрита при гонартрозе. Хондропротекторный эффект хондроитинсульфатов ACS4-ACS6]. Presse Med 9-14-2002;31(29):1386-1390. Посмотреть реферат.

Мацуно, Х., Накамура, Х., Катаяма, К., Хаяши, С., Кано, С., Юдо, К. и Кисо, Ю. Влияние перорального введения глюкозамина-хондроитин-кверцетин глюкозида на свойства синовиальной жидкости у больных остеоартрозом и ревматоидным артритом. Biosci.Biotechnol.Biochem. 2009;73(2):288-292. Посмотреть реферат.

Mazieres, B., Hucher, M., Zaim, M. и Garnero, P. Влияние хондроитинсульфата на симптоматический остеоартрит коленного сустава: многоцентровое, рандомизированное, двойное слепое, плацебо-контролируемое исследование.Энн Реум Дис 2007;66(5):639-645. Посмотреть реферат.

Michel, BA, Stucki, G., Frey, D., De, Vathaire F., Vignon, E., Bruehlmann, P., and Uebelhart, D. Хондроитин 4 и 6 сульфат при остеоартрите коленного сустава: рандомизированное исследование , контролируемое испытание. Ревмирующий артрит. 2005;52(3):779-786. Посмотреть реферат.

Моллер, И., Перес, М., Монфор, Дж., Бенито, П., Куэвас, Дж., Перна, К., Доменек, Г., Эрреро, М., Монтелл, Э., и Вергес, J. Эффективность хондроитинсульфата у пациентов с сопутствующим остеоартритом коленного сустава и псориазом: рандомизированное двойное слепое плацебо-контролируемое исследование.Остеоартрит. Хрящ. 2010;18 Приложение 1:S32-S40. Посмотреть реферат.

Наказава К. и Мурата К. Сравнительное исследование эффектов изомеров хондроитинсульфата на пациентов с атеросклерозом. ЗФА. 1979;34(2):153-159. Посмотреть реферат.

Наказава К., Мурата К., Изука К. и Осима Ю. Кратковременное воздействие хондроитинсульфатов А и С на пациентов с коронарным атеросклерозом: в отношении его антитромбогенной активности. Jpn.Heart J 1969;10(4):289-296. Посмотреть реферат.

Никель, Дж.К., Эгерди Б., Дауни Дж., Сингх Р., Скехан А., Карр Л. и Ирвин-Берд К. Реальное многоцентровое клиническое практическое исследование для оценки эффективности и безопасности внутрипузырный хондроитин сульфат для лечения интерстициального цистита. БЖУ.Инт. 2009;103(1):56-60. Посмотреть реферат.

Nickel, JC, Egerdie, RB, Steinhoff, G., Palmer, B., and Hanno, P. Многоцентровая, рандомизированная, двойная слепая, параллельная экспериментальная оценка эффективности и безопасности внутрипузырного введения хондроитинсульфата натрия по сравнению с носителем контроль у пациентов с интерстициальным циститом/синдромом болезненного мочевого пузыря.Урология 2010;76(4):804-809. Посмотреть реферат.

Никель, Дж. К., Ханно, П., Кумар, К., и Томас, Х. Вторая многоцентровая, рандомизированная, двойная слепая, параллельная групповая оценка эффективности и безопасности внутрипузырного введения хондроитинсульфата натрия по сравнению с контролем неактивного носителя у субъектов с интерстициальным циститом/синдромом боли в мочевом пузыре. Урология 2012;79(6):1220-1224. Посмотреть реферат.

Nordling, J. and van, Ophoven A. Внутрипузырное восполнение гликозаминогликанов хондроитинсульфатом при хронических формах цистита.Многонациональное, многоцентровое, проспективное обсервационное клиническое исследование. Арцнаймиттельфоршунг. 2008;58(7):328-335. Посмотреть реферат.

O’Rourke, M. Определение эффективности глюкозамина и хондроитина при остеоартрите. Практика медсестер 2001; 26 (6): 44–52. Посмотреть реферат.

Оливьеро, У., Соррентино, Г.П., Де Паола, П., Транфалья, Э., Д’Алессандро, А., Карифи, С., Порфидо, Ф.А., Серио, Р., Грассо, А.М., Поличиккио, Д. ., а также . Эффекты лечения матрицей у пожилых людей с хронической дегенерацией суставов.Drugs Exp Clin Res 1991;17(1):45-51. Посмотреть реферат.

Павелка и др. Двойное слепое исследование эффекта дозы пероральных CS 4 и 6 1200 мг, 800 мг, 200 мг в сравнении с плацебо при лечении бедренно-большеберцового остеоартрита. Wular Rheumatol Liter 1998; 27 (дополнение 2): 63.

Pavelka, K., Coste, P., Geher, P. и Krejci, G. Эффективность и безопасность пиаскледина 300 по сравнению с хондроитинсульфатом при 6-месячном лечении плюс 2-месячное наблюдение у пациентов с остеоартритом коленного сустава. Клин.Ревматол.2010;29(6):659-670. Посмотреть реферат.

Порру Д., Червиньи М., Наста Л., Натале Ф., Ло, Вой Р., Тинелли К., Гарделла Б., Ангилери А., Спинилло А. и Роверето , B. Результаты эндовезикального применения гиалуроновой кислоты/хондроитинсульфата при лечении интерстициального цистита/синдрома болезненного мочевого пузыря. Rev.Recent Clin.Trials 2008;3(2):126-129. Посмотреть реферат.

Praveen, M.R., Koul, A., Vasavada, A.R., Pandita, D., Dixit, N.V., и Dahodwala, F.F. DisCoVisc в сравнении с методом мягких оболочек с использованием Viscoat и Provisc при факоэмульсификации: рандомизированное клиническое исследование.J.Cataract Refract.Surg. 2008;34(7):1145-1151. Посмотреть реферат.

Railhac, JJ, Zaim, M., Saurel, AS, Vial, J. и Fournie, B. Влияние 12-месячного лечения хондроитинсульфатом на объем хряща у пациентов с остеоартритом коленного сустава: рандомизированное, двойное слепое, плацебо- контролируемое пилотное исследование с использованием МРТ. Клин.Ревматол. 2012;31(9):1347-1357. Посмотреть реферат.

Rainer, G., Stifter, E., Luksch, A., и Menapace, R. Сравнение влияния Viscoat и DuoVisc на послеоперационное внутриглазное давление после хирургии катаракты с малым разрезом.J.Cataract Refract.Surg. 2008;34(2):253-257. Посмотреть реферат.

Рейнсфорд, К. Д. Важность фармацевтического состава и данных клинических испытаний и фармакологических исследований в определении эффективности хондроитинсульфата и других гликозаминогликанов: критический анализ. J.Pharm.Pharmacol. 2009;61(10):1263-1270. Посмотреть реферат.

Ренч, К., Ренч, Б., Брейер, А., Спекль, К., Юнг, Р., Мантей, С., Шарнвебер, Д., Цвипп, Х., и Бивенер, А. Длинная кость дефекты критического размера, обработанные тканевыми каркасами из поликапролактона-колактида: экспериментальное исследование на крысах.J.Biomed.Mater.Res.A 12-1-2010;95(3):964-972. Посмотреть реферат.

Роветта, Г. Сульфат галактозаминоглиуроногликанов (матрикс) в терапии большеберцового остеоартрита коленного сустава. Drugs Exp Clin Res 1991;17(1):53-57. Посмотреть реферат.

Роветта Г., Монтефорте П., Мольфетта Г. и Балестра В. Двухлетнее исследование хондроитинсульфата при эрозивном остеоартрите рук: поведение эрозий, остеофитов, боль и дисфункция рук. Drugs Exp Clin Res 2004;30(1):11-16. Посмотреть реферат.

Роветта Г., Монтефорте П., Мольфетта Г. и Балестра В. Хондроитинсульфат при эрозивном остеоартрите рук. Int J Tissue React. 2002;24(1):29-32. Посмотреть реферат.

Сасисекаран Р. и Шрайвер З. От кризиса к возможностям: взгляд на гепариновый кризис. Тромб.Гемост. 2009;102(5):854-858. Посмотреть реферат.

Савицке, А. Д., Ши, Х., Финко, М. Ф., Данлоп, Д. Д., Бингем, К. О., III, Харрис, К. Л., Сингер, Н. Г., Брэдли, Дж. Д., Сильвер, Д., Джексон, К.G., Lane, NE, Oddis, CV, Wolfe, F., Lisse, J., Furst, DE, Reda, DJ, Moskowitz, RW, Williams, HJ, and Clegg, DO Влияние глюкозамина и/или хондроитинсульфата о прогрессировании остеоартрита коленного сустава: отчет о вмешательстве при артрите с глюкозамином/хондроитином. Ревмирующий артрит. 2008;58(10):3183-3191. Посмотреть реферат.

Савицке, А. Д., Ши, Х., Финко, М. Ф., Данлоп, Д. Д., Харрис, К. Л., Сингер, Н. Г., Брэдли, Д. Д., Сильвер, Д., Джексон, К. Г., Лейн, Н.E., Oddis, CV, Wolfe, F., Lisse, J., Furst, DE, Bingham, CO, Reda, DJ, Moskowitz, RW, Williams, HJ, and Clegg, DO Клиническая эффективность и безопасность глюкозамина, хондроитинсульфата , их комбинация, целекоксиб или плацебо, принимаемые для лечения остеоартрита коленного сустава: 2-летние результаты ГАИТ. Энн.Реум.Дис. 2010;69(8):1459-1464. Посмотреть реферат.

Шульц А., Вествебер А. М. и Дресслер Д. Противовоспалительное действие препарата гиалуроновой кислоты и хондроитинсульфата на модели мочевого пузыря in vitro.Актуэль Урол. 2009;40(2):109-112. Посмотреть реферат.

Steinhoff, G., Ittah, B. и Rowan, S. Эффективность хондроитинсульфата 0,2% при лечении интерстициального цистита. Can J Urol 2002;9(1):1454-1458. Посмотреть реферат.

Tat, S.K., Pelletier, J.P., Mineau, F., Duval, N., и Martel-Pelletier, J. Различные эффекты 3 различных соединений хондроитинсульфата на остеоартритный хрящ/хондроциты человека: актуальность чистоты и производственного процесса. Дж.Ревматол. 2010;37(3):656-664.Посмотреть реферат.

Теохарис, Д. А., Скандалис, С. С., Ноулас, А. В., Папагеоргакопулу, Н., Теохарис, А. Д., и Караманос, Н. К. Протеогликаны гиалуронана и хондроитинсульфата в надмолекулярной организации стекловидного тела млекопитающих. Connect.Tissue Res. 2008;49(3):124-128. Посмотреть реферат.

Thilo, G. [Исследование 35 случаев лечения артроза хондротииновой серной кислотой (перевод автора)]. Schweizerische Rundschau fur Medizin Praxis 12-27-1977;66(52):1696-1699.Посмотреть реферат.

Uebelhart D и Chantraine A. Clinique Efficacite clinique du сульфат хондроитина против гонартроза: рандомизированное исследование двойного инсулина в сравнении с плацебо [аннотация]. Rev. Rhumatisme 1994; 10: 692.

Verbruggen, G., Goemaere, S., and Veys, E.M. Хондроитинсульфат: S/DMOAD (препарат против остеоартрита, модифицирующий структуру/заболевание) при лечении ОА суставов пальцев. Osteoarthritis Cartilage 1998;6 Suppl A:37-38. Посмотреть реферат.

Volpi, N. Пероральная биодоступность хондроитинсульфата (Condrosulf) и его компонентов у здоровых мужчин-добровольцев.Остеоартрит. Хрящ. 2002;10(10):768-777. Посмотреть реферат.

Wildi, LM, Raynauld, JP, Martel-Pelletier, J., Beaulieu, A., Bessette, L., Morin, F., Abram, F., Dorais, M. и Pelletier, JP. потеря объема хряща и поражение костного мозга у пациентов с остеоартритом коленного сустава, начиная уже через 6 месяцев после начала терапии: рандомизированное двойное слепое плацебо-контролируемое пилотное исследование с использованием МРТ. Энн.Реум.Дис. 2011;70(6):982-989. Посмотреть реферат.

Юэ Дж., Ян М., Йи С., Донг Б., Ли В., Ян З., Лу Дж., Чжан Р. и Юн Дж. Хондроитинсульфат и / или гидрохлорид глюкозамина при болезни Кашина-Бека: кластерное рандомизированное плацебо-контролируемое исследование. Остеоартрит. Хрящ. 2012;20(7):622-629. Посмотреть реферат.

Чжан В., Московиц Р.В., Нуки Г., Абрамсон С., Альтман Р.Д., Арден Н., Бирма-Зейнстра С., Брандт К.Д., Крофт П., Доэрти М. , Дугадос М., Хохберг М., Хантер Д.Дж., Квох К., Ломандер Л.S., и Tugwell, P. Рекомендации OARSI по лечению остеоартрита тазобедренного и коленного суставов, Часть II: Рекомендации OARSI, основанные на фактических данных, консенсус экспертов. Остеоартрит. Хрящ. 2008;16(2):137-162. Посмотреть реферат.

Zhou, Q., Chen, H., Qu, M., Wang, Q., Yang, L., and Xie, L. Разработка новой ex vivo модели прилипания грибка роговицы. Graefes Arch.Clin.Exp.Ophthalmol. 2011;249(5):693-700. Посмотреть реферат.

Adebowale AO, Cox DS, Liang Z, et al. Анализ содержания глюкозамина и хондроитинсульфата в продаваемых продуктах и ​​проницаемости Caco-2 сырья для хондроитинсульфата.ЯНА 2000;3:37-44.

Andermann G, Dietz M. Влияние пути введения на биодоступность эндогенной макромолекулы: хондроитинсульфата (CSA). Eur J Drug Metab Pharmacokinet 1982;7:11-6. Посмотреть реферат.

Багасра О., Уиттл П., Хейнс Б., Померанц Р.Дж. Активность сульфатированных моносахаридов против вируса иммунодефицита человека 1 типа: сравнение с сульфатированными полисахаридами и другими полиионами. J Infect Dis 1991;164:1082-90. Посмотреть реферат.

Байчи А., Хорлер Д., Мозер Б. и др.Анализ гликозаминогликанов в сыворотке крови человека после перорального приема хондроитинсульфата. Rheumatol Int 1992;12:81-8.. Посмотреть реферат.

Барнхилл Дж. Г., Фай К. Л., Уильямс Д. В., Реда Д. Д., Харрис К. Л., Клегг Д. О. Выбор продукта хондроитина для исследования вмешательства при артрите с глюкозамином/хондроитином. J Am Pharm Assoc (2003) 2006;46(1):14-24. Посмотреть реферат.

Буржуа П., Чалес Г., Дехайс Дж. и др. Эффективность и переносимость хондроитинсульфата 1200 мг/день по сравнению с хондроитинсульфатом 3 x 400 мг/день по сравнению с плацебо.Хрящевой остеоартрит 1998; 6:25-30. Посмотреть реферат.

Брей Х.Г., Грегори Дж.Э., Стейси М. Химия тканей. 1. Хондроитин из хрящей. Biochem J 1944; 38:142-146.

Брюйер О., Купер С., Пеллетье Дж. П. и др. Консенсусное заявление по алгоритму Европейского общества клинических и экономических аспектов остеопороза и остеоартрита (ESCEO) для лечения остеоартрита коленного сустава – от доказательной медицины к реальным условиям. Семин Ревмирующий артрит. 2016;45(4 Приложение):S3-11.Посмотреть реферат.

Bucsi L, Poor G. Эффективность и переносимость перорального хондроитинсульфата в качестве симптоматического препарата медленного действия для лечения остеоартрита (SYSADOA) при лечении остеоартрита коленного сустава. Osteoarthritis Cartilage 1998;6 Suppl A:31-6. Посмотреть реферат.

Берк С., Шугар Дж., Фарбер, доктор медицины. Сравнение влияния двух вязкоупругих агентов Healon и Viscoat на послеоперационное внутриглазное давление после сквозной кератопластики. Офтальмологический хирург 1990;21:821-6. Посмотреть реферат.

Cao LC, Boeve ER, de Bruijn WC, et al. Гликозаминогликаны и полусинтетические сульфатированные полисахариды: обзор их потенциального применения в лечении больных мочекаменной болезнью. Урология 1997;50:173-83. Посмотреть реферат.

Cerda C, Bruguera M, Parés A. Гепатотоксичность, связанная с сульфатом глюкозамина и хондроитина у пациентов с хроническими заболеваниями печени. World J Gastroenterol 2013;19(32):5381-4. Посмотреть реферат.

Чавес МЛ. Глюкозамина сульфат и хондроитин сульфат.Хосп Фарм 1997;32:1275-85.

Клегг Д.О., Реда Д.Дж., Харрис С.Л. и др. Глюкозамин, хондроитинсульфат и их комбинация при болезненном остеоартрите коленного сустава. N Engl J Med 2006;354:795-808. Посмотреть реферат.

Cohen M, Wolfe R, Mai T, Lewis D. Рандомизированное двойное слепое плацебо-контролируемое исследование крема для местного применения, содержащего сульфат глюкозамина, сульфат хондроитина и камфору, для лечения остеоартрита коленного сустава. J Rheumatol 2003;30:523-8.. Посмотреть реферат.

Конрозье Т.[Противоартрозное лечение: эффективность и переносимость хондроитинсульфатов]. Presse Med 1998; 27:1862-5. Посмотреть реферат.

Конте А., де Бернарди М., Палмиери Л. и др. Метаболическая судьба экзогенного хондроитинсульфата у человека. Arzneimittelforschung 1991; 41:768-72. Посмотреть реферат.

Конте А., Вольпи Н., Пальмиери Л. и др. Биохимические и фармакокинетические аспекты перорального лечения хондроитинсульфатом. Arzneimittelforschung 1995;45:918-25. Посмотреть реферат.

Данао-Камара Т.Возможные побочные эффекты лечения глюкозамином и хондроитином. Arthritis Rheum 2000;43:2853. Посмотреть реферат.

Дас А. Младший, Хаммад Т.А. Эффективность комбинации гидрохлорида глюкозамина FCHG49, низкомолекулярного хондроитинсульфата натрия TRh222 и аскорбата марганца при лечении остеоартрита коленного сустава. Хрящевой остеоартрит 2000;8:343-50. Посмотреть реферат.

De Vita D, Antell H, Giordano S. Эффективность внутрипузырного введения гиалуроновой кислоты с хондроитинсульфатом или без него при рецидивирующем бактериальном цистите у взрослых женщин: метаанализ.Int Urogynecol J 2013;24(4):545-52. Посмотреть реферат.

Ди Каро А., Перола Э., Бартолини Б. и др. Фракции химически сверхсульфатированных сульфатов галактозаминогликанов ингибируют три оболочечных вируса: вирус иммунодефицита человека типа 1, вирус простого герпеса типа 1 и цитомегаловирус человека. Antivir Chem Chemother 1999;10:33-8.. Посмотреть аннотацию.

FDA выдает допродажное одобрение Viscoat. Стандарты биомедицинской безопасности 1986;16(11):82.

Управление по санитарному надзору за качеством пищевых продуктов и медикаментов. Предпродажное одобрение (PMA). Доступно по адресу: http://www.accessdata.fda.gov/scripts/cdrh/cfdocs/cfpma/pma.cfm?id=20196.

Совет по пищевым продуктам и питанию, Медицинский институт. Рекомендуемые нормы потребления витамина А, витамина К, мышьяка, бора, хрома, меди, йода, железа, марганца, молибдена, никеля, кремния, ванадия и цинка. Вашингтон, округ Колумбия: National Academy Press, 2002. Доступно по адресу: www.nap.edu/books/03094/html/.

Франсен М., Агалиотис М., Нэрн Л., Вотрубек М., Бриджит Л., Су С., Ян С., Марч Л., Эдмондс Дж., Нортон Р., Вудворд М., Дэй Р.; Исследовательская группа LEGS.Глюкозамин и хондроитин при остеоартрозе коленного сустава: двойное слепое рандомизированное плацебо-контролируемое клиническое исследование, оценивающее одиночные и комбинированные режимы. Энн Реум Дис 2015; 74 (5): 851-8. Посмотреть реферат.

Габай С., Медингер-Садовски С., Гаскон Д. и др. Симптоматическое влияние хондроитина 4 и хондроитин 6 сульфата на остеоартрит рук: рандомизированное двойное слепое плацебо-контролируемое клиническое исследование в одном центре. Arthritis Rheum 2011;63:3383-91. Посмотреть реферат.

Гаурудер-Бурместер А., Попкен Г.Последующее наблюдение через 24 месяца после лечения гиперактивного мочевого пузыря 0,2% хондроитинсульфатом натрия. Aktuelle Urol 2009;40:355-9. Посмотреть реферат.

Гринли Х., Крю К.Д., Шао Т., Кранвинкель Г., Калински К., Маурер М., Брафман Л., Инсел Б., Цай В.Ю., Хершман Д.Л. Исследование фазы II глюкозамина с хондроитином при симптомах суставов, связанных с ингибитором ароматазы, у женщин с раком молочной железы. Support Care Cancer 2013;21(4):1077-87. Посмотреть реферат.

Henry-Launois B. Оценка финансового воздействия Chondrosulf 400 на текущую медицинскую практику.Часть материалов научного симпозиума, проведенного на XI симпозиуме EULAR: Новые подходы к ОА: хондроитинсульфат (CS 4 и 6), а не просто симптоматическое лечение. Geneva, 1998.

Hochberg MC, Martel-Pelletier J, Monfort J, Möller I, Castillo JR, Arden N, Berenbaum F, Blanco FJ, Conaghan PG, Doménech G, Henrotin Y, Pap T, Richette P, Sawitzke A, дю Суиш П., Пеллетье Дж. П.; от имени Исследовательской группы MOVES. Комбинированный хондроитинсульфат и глюкозамин при болезненном остеоартрозе коленного сустава: многоцентровое рандомизированное двойное слепое исследование не меньшей эффективности по сравнению с целекоксибом.Энн Реум Дис 2016;75(1):37-44. Посмотреть реферат.

Хуанг Дж., Оливенштейн Р., Таха Р. и др. Повышенное отложение протеогликанов в стенке дыхательных путей у атопических астматиков. Am J Respir Crit Care Med 1999;160:725-9. Посмотреть реферат.

Jackson, CG, Plaas, AH, Sandy, JD, Hua, C., Kim-Rolands, S., Barnhill, JG, Harris, CL, and Clegg, DO Фармакокинетика человека при пероральном приеме глюкозамина и хондроитинсульфата отдельно или в комбинации. Хрящевой остеоартрит 2010;18(3):297-302.Посмотреть реферат.

Jurkiewicz E, Panse P, Jentsch KD, et al. Анти-ВИЧ-1 активность полисульфата хондроитина in vitro. СПИД 1989;3:423-7. Посмотреть реферат.

Kahan A. STOPP (Исследование предотвращения прогрессирования остеоартрита): новое двухлетнее исследование хондроитин 4 и 6 сульфата (CS). Доступно по адресу: www.ibsa-ch.com/eular_2006_amsterdam_vignon-2.pdf (по состоянию на 25 апреля 2007 г.).

Келли Г.С. Роль глюкозамина сульфата и хондроитинсульфата в лечении дегенеративных заболеваний суставов.Altern Med Rev 1998; 3:27-39. Посмотреть реферат.

Кнудсен Дж., Сокол Г.Х. Потенциальное взаимодействие глюкозамина и варфарина, приводящее к увеличению международного нормализованного отношения: клинический случай и обзор литературы и базы данных MedWatch. Фармакотерапия 2008;28:540-8. Посмотреть реферат.

Лаудер РМ. Хондроитинсульфат: сложная молекула с потенциальным воздействием на широкий спектр биологических систем. Дополнение Ther Med 2009;17(1):56-62. Посмотреть реферат.

Ли, Ю. Х., Ву, Дж. Х., Чой, С.Дж., Джи, Дж.Д., и Сонг, Г.Г. Влияние глюкозамина или хондроитинсульфата на прогрессирование остеоартрита: метаанализ. Rheumatol Int 2010;30(3):357-363. Посмотреть реферат.

Leeb BF, Petera P, Neumann K. Результаты многоцентрового исследования применения хондроитинсульфата (Condrosulf) при артрозе пальцевых, коленных и тазобедренных суставов. Wien Med Wochenschr 1996;146:609-14. Посмотреть реферат.

Лееб Б.Ф., Швейцер Х., Монтаг К., Смолен И.С. Метаанализ хондроитинсульфата при лечении остеоартрита.Дж. Ревматол 2000; 27:205-11. Посмотреть реферат.

Leffler CT, Philippi AF, Leffler SG, et al. Глюкозамин, хондроитин и аскорбат марганца при дегенеративных заболеваниях коленного сустава или нижней части спины: рандомизированное двойное слепое плацебо-контролируемое пилотное исследование. Мил Мед 1999;164:85-91. Посмотреть реферат.

Льюис Си Джей. Письмо, подтверждающее определенные опасения по поводу общественного здравоохранения и безопасности для фирм, производящих или импортирующих пищевые добавки, содержащие определенные ткани крупного рогатого скота. Управление по санитарному надзору за качеством пищевых продуктов и медикаментов. Доступно на: www.cfsan.fda.gov/~dms/dspltr05.html.

Лимберг М.Б., МакКаа С., Кисслинг Г.Э., Кауфман Х.Е. Местное применение гиалуроновой кислоты и хондроитинсульфата при лечении сухости глаз. Ам Дж. Офтальмол 1987; 103:194-7. Посмотреть реферат.

Ламас-Морено Х.Ф., Байса-Дуран Л.М., Сауседо-Родригес Л.Р., Аланис-Де ла О Х.Ф. Эффективность и безопасность хондроитинсульфата/ксантановой камеди по сравнению с полиэтиленгликолем/пропиленгликолем/гидроксипропилгуаром у пациентов с синдромом сухого глаза. Клин Офтальмол 2013;7:995-9. Посмотреть реферат.

Мазьер Б., Комб Б., Фан Ван А. и др. Хондроитинсульфат при остеоартрозе коленного сустава: проспективное двойное слепое плацебо-контролируемое многоцентровое клиническое исследование. Дж. Ревматол 2001; 28:173-81. Посмотреть реферат.

Мазьер Б., Лойо Г., Менкес С.Дж. и др. Хондроитин сульфат в лечении гонартроза и коксартроза. 5-месячный результат многоцентрового двойного слепого контролируемого проспективного исследования с использованием плацебо]. Rev Rhum Mal Osteoartic 1992;59:466-72. Посмотреть реферат.

McAlindon TE, LaValley MP, Gulin JP, Felson DT.Глюкозамин и хондроитин для лечения остеоартрита: систематическая оценка качества и метаанализ. ДЖАМА 2000; 283:1469-75. Посмотреть реферат.

Мессье С.П., Михалко С., Лозер Р.Ф. и др. Глюкозамин/хондроитин в сочетании с физическими упражнениями для лечения остеоартрита коленного сустава: предварительное исследование. Хрящевой остеоартрит 2007;15:1256-66. Посмотреть реферат.

Морреале П., Манопуло Р., Галати М. и др. Сравнение противовоспалительной эффективности хондроитинсульфата и диклофенака натрия у пациентов с остеоартрозом коленного сустава.Дж. Ревматол 1996; 23:1385-91. Посмотреть реферат.

Моррисон Л.М., Баджва Г.С., Альфин-Слейтер Р.Б., Эршофф Б.Х. Профилактика сосудистых поражений хондроитинсульфатом А в коронарной артерии и аорте крыс, индуцированных гипервитаминозом D, холестеринсодержащей диетой. Атеросклероз 1972;16:105-18. Посмотреть реферат.

Моррисон Л.М., Энрик Н. Ишемическая болезнь сердца: снижение смертности с помощью хондроитинсульфата А. Ангиология 1973;24:269-87. Посмотреть реферат.

Моррисон Л.М. Лечение коронарной артериосклеротической болезни сердца хондроитинсульфатом-А: предварительный отчет.J Am Geriatr Soc 1968; 16:779-85. Посмотреть реферат.

Palmieri B, Merighi A, Corbascio D, Rottigni V, Fistetto G, Esposito A. Фиксированная комбинация гиалуроновой кислоты и хондроитинсульфата для перорального применения в рандомизированном двойном слепом плацебо-контролируемом исследовании лечения симптомов у пациентов с не- эрозивный гастроэзофагеальный рефлюкс. Eur Rev Med Pharmacol Sci 2013;17(24):3272-8. Посмотреть реферат.

Пипитоне VR. Хондропротекция хондроитин сульфатом. Наркотики Exp Clin Res 1991;17:3-7 .Посмотреть реферат.

Provenza JR, Shinjo SK, Silva JM, Peron CR, Rocha FA. Комбинация глюкозамина и хондроитинсульфата один или три раза в день обеспечивает клинически значимую анальгезию при остеоартрите коленного сустава. Clin Rheumatol 2015; 34:1455-62. См. аннотацию.

Reginster JY, Dudler J, Blicharski T, Pavelka K. Хондроитин сульфат фармацевтического класса так же эффективен, как целекоксиб, и превосходит плацебо при симптоматическом остеоартрите коленного сустава: исследование ХОНдроитина, целекоксиба и плацебо (CONCEPT).Энн Реум Дис. 2017 22 мая. pii: annrheumdis-2016-210860. Посмотреть реферат.

Райхенбах С., Стерчи Р., Шерер М. и др. Мета-анализ: хондроитин при остеоартрозе коленного или тазобедренного сустава. Энн Интерн Мед 2007;146:580-90. Посмотреть реферат.

Ricciardelli C, Quinn DI, Raymond WA, et al. Повышенные уровни перитуморального хондроитинсульфата являются предикторами плохого прогноза у пациентов, перенесших радикальную простатэктомию по поводу рака предстательной железы на ранней стадии. Рак Res 1999; 59: 2324-8. Посмотреть реферат.

Richy F, Bruyere O, Ethgen O, et al. Структурная и симптоматическая эффективность глюкозамина и хондроитина при остеоартрозе коленного сустава: всесторонний метаанализ. Arch Intern Med 2003; 163: 1514-22. Посмотреть реферат.

Ронка Ф., Палмьери Л., Паникуччи П. и др. Противовоспалительное действие хондроитинсульфата. Osteoarthritis Cartilage 1998;6 Suppl A:14-21. Посмотреть реферат.

Розенфельд В., Крейн Д.Л., Каллахан А.К. Возможно усиление эффекта варфарина глюкозамин-хондроитином.Am J Health Syst Pharm 2004;61:306-307. Посмотреть реферат.

Сакко А.Дж., Риччарделли С., Мейн К. и др. Модуляция прикрепления клеток рака предстательной железы к матриксу с помощью версикана. Рак Res 2003;63:4786-91. Посмотреть реферат.

Schneider H, Maheu E, Cucherat M. Модифицирующий симптом эффект хондроитинсульфата при остеоартрите коленного сустава: метаанализ рандомизированных плацебо-контролируемых исследований, проведенных с применением structum®. Open Rheumatol J. 2012;6:183-9. Посмотреть реферат.

Сильвестро Л., Лансаротти Э., Марчи Э. и др.Фармакокинетика гликозаминогликанов человека с использованием меченых дейтерием и немеченых веществ: доказательства перорального всасывания. Семин Тромб Хемост 1994;20:281-92. Посмотреть реферат.

Сингх Дж. А., Нурбалучи С., Макдональд Р., Максвелл Л. Дж. Хондроитин при артрозе. Cochrane Database Syst Rev. 2015 Jan 28;1:CD005614. Посмотреть реферат.

Таллия А.Ф., Кардоне Д.А. Обострение астмы, связанное с добавкой глюкозамина-хондроитина. J Am Board Fam Pract 2002;15:481-4.. Посмотреть аннотацию.

Теохаридес, Т. С., Кемпурадж, Д., Вакали, С., и Сант, Г. Р. Лечение рефрактерного интерстициального цистита/синдрома болезненного мочевого пузыря с помощью CystoProtek — пероральной многокомпонентной натуральной добавки. Can J Urol 2008;15(6):4410-4414. Посмотреть реферат.

Torella M, Schettino MT, Salvatore S, Serati M, De Franciscis P, Colacurci N. Внутрипузырная терапия при рецидивирующем цистите: многоцентровый опыт. J Infect Chemother 2013;19(5):920-5. Посмотреть реферат.

Юбельхарт Д., Кнуссель О., Тейлер Р.Эффективность и переносимость перорального птичьего хондроитинсульфата при болезненном остеоартрите коленного сустава [аннотация]. Schweiz Med Wochenschr 1999; 129:1174.

Uebelhart D, Malaise M, Marcolongo R, et al. Прерывистое лечение остеоартрита коленного сустава пероральным хондроитинсульфатом: однолетнее рандомизированное двойное слепое многоцентровое исследование по сравнению с плацебо. Остеоартрит хрящей 2004;12:269-76. Посмотреть реферат.

Uebelhart D, Thonar EJ, Delmas PD, et al. Влияние перорального хондроитинсульфата на прогрессирование остеоартрита коленного сустава: экспериментальное исследование.Хрящевой остеоартрит 1998; 6:39-46. Посмотреть реферат.

Verbruggen G, Goemaere S, Veys EM. Системы для оценки прогрессирования остеоартрита суставов пальцев и эффектов лекарств от остеоартрита, модифицирующих заболевание. Клин Ревматол 2002;21:231-43. Посмотреть реферат.

Verges J, Montell E, Herrero M, et al. Клинические и гистопатологические улучшения при псориазе при пероральном приеме хондроитинсульфата: счастливая находка. Dermatol Online J 2005; 11:31. Посмотреть реферат.

Виган М.Аллергический контактный дерматит, вызванный хондроитинсульфатом натрия, содержащимся в косметическом креме. Контактный дерматит 2014;70(6):383-4. Посмотреть реферат.

Volpi N. Качество различных препаратов хондроитинсульфата в зависимости от их терапевтической активности. J Pharm Pharmacol 2009;61(10):1271-80. Посмотреть реферат.

von Felden J, Montani M, Kessebohm K, Stickel F. Лекарственное острое повреждение печени, имитирующее аутоиммунный гепатит после приема пищевых добавок, содержащих глюкозамин и хондроитинсульфат.Int J Clin Pharmacol Ther 2013;51(3):219-23. Посмотреть реферат.

Wandel, S., Juni, P., Tendal, B., Nuesch, E., Villiger, PM, Welton, NJ, Reichenbach, S. и Trelle, S. Эффекты глюкозамина, хондроитина или плацебо у пациентов с остеоартритом тазобедренного или коленного сустава: сетевой метаанализ. BMJ 2010;341:c4675. Посмотреть реферат.

Юлисастиги Л., Бакри Ю., Амзази С. и др. Растворимые гликозаминогликаны Не усиливают противовирусную активность RANTES при инфицировании первичных макрофагов вирусом иммунодефицита человека типа 1.Вирусология 2000;278:412-22. Посмотреть реферат.

Yue QY, Strandell J, Myrberg O. Одновременное применение глюкозамина может вызвать эффект варфарина. Центр мониторинга Уппсалы. Доступно по адресу: www.who-umc.org/graphics/9722.pdf (по состоянию на 28 апреля 2008 г.).

Зегельс Б., Крозес П., Убельхарт Д., Брюйер О., Регинстер Дж.Ю. Эквивалентность однократной дозы (1200 мг) по сравнению с трехразовой дозой (400 мг) хондроитин 4 и 6 сульфата у пациентов с остеоартритом коленного сустава. Результаты рандомизированного двойного слепого плацебо-контролируемого исследования.Хрящевой остеоартрит 2013;21(1):22-7. Посмотреть реферат.

Zhang YX, Dong W, Liu H и др. Эффекты хондроитинсульфата и глюкозамина у взрослых пациентов с болезнью Кашина-Бека. Клин Ревматол 2010;29:357-62. Посмотреть реферат.

.