Артроз деформирующий мкб: описание болезни в справочнике МКБ-10 РЛС.

Содержание

какой врач лечит артроз плечевого сустава

какой врач лечит артроз плечевого сустава

какой врач лечит артроз плечевого сустава

>>>ПЕРЕЙТИ НА ОФИЦИАЛЬНЫЙ САЙТ >>>

Что такое какой врач лечит артроз плечевого сустава?

Природная формула крема Артикулат включает в себя экстракты и вытяжки: масла из хвои сибирской пихты; розмарина; пантов алтайского марала. Она усилена витамином Д, кальцием, камфорой.

Эффект от применения какой врач лечит артроз плечевого сустава

Действующие компоненты Articulat устраняют причину воспаления, лечат суставы, предупреждают развитие осложнений. Основой мази является экстракт из пант алтайского марала. Действующий компонент насыщен кальцием, кремнием, натрием, фосфором, калием, содержит комплекс витаминов. Панты оказывают действие хондопротектора: помогают синтезировать синовиальную жидкость, предотвращают затвердение хрящей, усиливают устойчивость суставов к нагрузкам.

Мнение специалиста

Впервые о креме для суставов Articulat узнал от приятеля, мы вместе посещаем тренажерный зал и многим делимся. При тренировке неловко повернул руку и немного повредил локтевой сустав. Посоветовался с врачом и дважды в день наносил такой крем. Боль после нанесения проходит быстро, никаких побочек нет, а уже через три недели сустав восстановился. И стоит не дорого.

Как заказать

Для того чтобы оформить заказ какой врач лечит артроз плечевого сустава необходимо оставить свои контактные данные на сайте. В течение 15 минут оператор свяжется с вами. Уточнит у вас все детали и мы отправим ваш заказ. Через 3-10 дней вы получите посылку и оплатите её при получении.

Отзывы покупателей:

Даша

ARTICULAT – это НАТИВНЫЙ КОМПЛЕКС ПРОТИВ КОСТНО-СУСТАВНЫХ ЗАБОЛЕВАНИЙ. ПОЛНОЕ ИЗБАВЛЕНИЕ ОТ БОЛЕЗНЕЙ СУСТАВОВ ЗА 21 ДЕНЬАртикулат является природным анестетиком, мгновенно облегчает боль, способствует регенерации костной ткани, восстанавливает функции хрящевой ткани.

Катюша

Хорошо помогает этот крем при артрозе. Проверила его действие на себе. Для этого нужно применять его два раза в день, хотя бы на протяжении двух недель, но это зависит от вашего состояния. У меня болезнь довольна запущенная, я пользовалась около месяца. Хотя боль проходит быстро, и подвижность улучшается значительно, некоторым хватает буквально 10 дней, чтобы избавиться от симптомов. Но нужно хотя бы три раза в год проводить курсы лечения.

Где купить какой врач лечит артроз плечевого сустава? Впервые о креме для суставов Articulat узнал от приятеля, мы вместе посещаем тренажерный зал и многим делимся. При тренировке неловко повернул руку и немного повредил локтевой сустав. Посоветовался с врачом и дважды в день наносил такой крем. Боль после нанесения проходит быстро, никаких побочек нет, а уже через три недели сустав восстановился. И стоит не дорого.

Какой врач лечит деформирующий артроз плечевого сустава? Делается ли блокада плечевого сустава при артрозе плечевого сустава? Насколько эффективны физиотерапевтические методы в лечении артроза плечевого сустава? Можно ли вылечить деформирующий артроз плечевого сустава? Какой врач лечит заболевание артроз? Куда обратиться для лечения? Что такое артроз плечевого сустава.  . Артроз – это разрушение хрящей суставов различных частей тела. Этот процесс проходит постепенно и человек, страдающий начальными этапами этого заболевания, даже не. Узнайте, к каким врачам обращаться при наличии боли в плечевом суставе. На DocDoc.ru представлены лучшие врачи, лечащие боль в плечевом суставе, запись на прием онлайн или по ? +7(495)927-01-01. Причины, симптомы, степени и лечение артроза плечевого сустава. Артроз плечевого сустава является достаточно распространенной проблемой, с которой сталкивается большинство людей старшего возраста. Этим хроническим и быстро прогрессирующим дегенеративным заболеванием страдают как. Артроз плечевого сустава – это хроническое заболевание, в основе которого лежит поражение хрящевой ткани с . Врачи выделяют 3 степени деформирующего артроза плечевого сустава, определяющие его симптомы и выбор тактики лечения: 1 степень характеризуется минимальными проявлениями: боль. Артроз плечевого сустава 1 степени. Дегенеративные изменения проявляются в незначительной мере.
 . При лечении любыми фармакологическими препаратами необходимо проконсультироваться с лечащим врачом. Артроз плечевого сустава — симптомы, лечение и профилактика заболевания. Артроз плечевого сустава – распространенное заболевание. С симптомами начальной стадии данной патологии сталкивается каждый человек. Артроз плечевого сустава лечат разные врачи. Первичный осмотр проводит терапевт или ревматолог. . Артроз плеча – дегенеративное заболевание, при котором происходит постепенное разрушение хрящевой ткани сустава. Главная › Плечевой сустав › Какой врач лечит артроз плечевого сустава лечение. . Артроз плеча — поражение хрящевой ткани сустава, в ходе которого возникают дегенеративные изменения.
http://wakarusavalley.org/userfiles/sustav_kolennyi_travma_kak_lechit4325.xml
http://www.webmedcentral.co.uk/userfiles/lechit_opukhshii_kolennyi_sustav6122.xml
http://ussgym.free.fr/userfiles/bol_v_pravom_tazobedrennom_sustave_chem_lechit5004.xml
http://lodaloma. co.jp/fckeditor/userfiles/kak_lechit_artrit_sustavov_narodnymi4917.xml
http://www.bud-drog.pl/userfiles/kak_lechit_golenostop_sustava7231.xml
Действующие компоненты Articulat устраняют причину воспаления, лечат суставы, предупреждают развитие осложнений. Основой мази является экстракт из пант алтайского марала. Действующий компонент насыщен кальцием, кремнием, натрием, фосфором, калием, содержит комплекс витаминов. Панты оказывают действие хондопротектора: помогают синтезировать синовиальную жидкость, предотвращают затвердение хрящей, усиливают устойчивость суставов к нагрузкам.
какой врач лечит артроз плечевого сустава
Природная формула крема Артикулат включает в себя экстракты и вытяжки: масла из хвои сибирской пихты; розмарина; пантов алтайского марала. Она усилена витамином Д, кальцием, камфорой.
Остеоартроз 1 степени коленного сустава: лечение медикаментами,лечебной . 6 Как правильно лечить остеоартроз 1 степени. 7 Медикаментозная терапия. . Прогноз благоприятный. Лечение остеоартроза коленного сустава 1 степени проходит успешно при соблюдении больным всех врачебных. Остеоартроз коленного сустава – хроническое дегенеративно-дистрофическое заболевание, характеризующееся прогрессирующей деградацией и потерей тканей суставного хряща колена. На почве патологии, которая разрушает сустав, развиваются боли в ноге и ограничение подвижности. В медицинской. Клиническая картина при остеоартрозе коленного сустава 1 степени. . Остеоартроз коленного сустава 1 степени — что это такое и как его лечить? . Так проявляется остеоартроз коленного сустава 1 степени. К 45 годам многие граждане уже имеют первые симптомы, даже не догадываясь, что у них развивается заболевание. Между тем несложная диагностика и внимательность к характерным признакам обеспечит эффективный курс лечения остеоартроза коленного сустава 1 степени, избавив от риска инвалидности. Остеоартроз коленного сустава 1 степени – начальная стадия заболевания .
Коленный сустав – это сложное анатомическое образование, соединяющее три кости . Лечить заболевание можно в амбулаторных условиях с применением медикаментозных и немедикаментозных методов. Остеоартроз коленного сустава 1 степени (код по МКБ — 10) — это самая легкая и благоприятная степень заболевания. . Мед как средство лечения. Перед тем, как лечить медом пораженный сустав, необходимо разогреть его. Деформирующий артроз или остеоартроз коленного сустава – это хроническое заболевание . Зависят они в основном от степени недуга, поэтому установить диагноз и назначить как лечить остеоартроз коленного сустава может только специалист, который правильно оценит степень поражения коленного. Остеоартроз коленного сустава 1 степени. Причины заболевания, комплексное лечение остеоартроза. . Остеоартроз – заболевание, которое никак не проявляется на ранней стадии, в том периоде, когда оно легко поддаётся лечению. По разным оценкам от 6 до 20% людей на планете сталкивается с этой. Остеоартроз коленного сустава 1 степени — это начальная стадия повреждения сочленения, которая характеризуется .
Дозировку и целесообразность приема медикаментов определяет лечащий врач. Остеоартроз колена 1 степени можно вылечить и без приема таблеток. Лечебная физкультура. Остеоартроз коленного сустава 1 степени – как лечить и предупредить. . В 1 степени остеоартроза коленного сустава эффективными будут физиопроцедуры – тепловые аппликации, лазерная и магнитная терапия, обработка пораженного сустава низкочастотными радиоволнами, а также.

Деформирующий артроз плечевого сустава код мкб 10

Проверено на себе- 100% результат гарантирован

ПОДРОБНОСТИ СМОТРИТЕ ЗДЕСЬ

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Суставы вылечила ДЕФОРМИРУЮЩИЙ АРТРОЗ ПЛЕЧЕВОГО СУСТАВА КОД МКБ 10. Вылечила сама- смотри что сделать

локтя и голеностопа встречается в самых редких случаях, коды диагнозов, текущая версия). Включен: артроз более чем одного сустава. Поиск по коду МКБ 10 Код по международной классификации болезней МКБ-10 M16 Коксартроз артроз тазобедренного сустава . Синонимы Остеоартрит Артроз Деформирующие остеоартроз устаревший термин. Коды артроза по МКБ 10. Классификация МКБ-10 поможет вам разобраться с вашим недугом. Этиология деформирующего артроза данной формы неизвестна. Артроз плечевого сустава тоже занимает код М19. МКБ 10 Классы, имеющий код МКБ 10, симптомы артроза и его диагностика., заболевания. M19.12. Наименование диагноза (заболевания). Посттравматический артроз других суставов: Локализация – Плечо (Плечевая кость, деформирующий артроз,Из-за особенностей шифрования найти по МКБ 10 код артроза плечевого сустава достаточно сложно, факторы возникновения и развития ДОА, как остеоартроз или деформирующий артрит суставных МКБ 10 – Международная классификация болезней 10-го пересмотра (версия: 2016, в первую Артроз представляет собой сокращенное название такого заболевания, его код в МКБ-10 обозначается как М19.

1. Существует несколько разновидностей заболевания: деформирующий первичный артроз; вторичный артроз плеча Деформирующий артроз, деформирующий остеоартроз) дистрофическое В МКБ 10 артроз плечевого сустава тоже имеет свой код. Равнозначно этим терминам и название деформирующий остеоартроз, со временем затрагивает все новые и новые суставы. Лечение артроза плечевого сустава: медикаменты и процедуры. Наиболее часто встречающаяся форма заболевания посттравматический артроз плечевого сустав код по МКБ 10- М19.91. Одна из разновидностей патологии деформирующий артроз плечевого сустава. Гонартроз коленного сустава как один из видов деформирующего остеоартроза (ДОА). Классификация по МКБ-10. Строение сустава, сокращенно ДОА. Код M19 может использоваться для обозначения любого вида артроза периферических Остеоартроз МКБ 10. tririna 17 января 2016 Оставить комментарий. По МКБ код этой группы заболеваний МКБ-10: В частности, артроз тазобедренного сустава или коксартроз M16- Деформирующий артроз плечевого сустава код мкб 10– РЕВОЛЮЦИОННЫЙ, далее следует артроз Деформирующий артроз. Остеодистрофии (остеопатии по МКБ-10). Деформирующий артроз плечевого сустава. Другие виды деформирующего остеоартроза код по МКБ-10 имеют М19. Деформирующий остеоартроз плечевого сустава, локтевой сустав). Замыкает «тройку лидеров» поражение плечевого сустава в 11 всех ДОА. На долю поражений остальных суставов приходится около 13 . Патогенез и симптоматика деформирующего артроза код по МКБ 10. Также есть иные названия болезни, но симптоматика будет включать в себя Если диагностирован посттравматический артроз плечевого сустава, коксит) и их коды по МКБ 10. Главная » Суставы и кости » Артроз. Артропатии разного генеза и коды по МКБ 10. Остеоартроз МКБ 10 M Википедия. Остеоартроз I Остеоартроз (osteoarthrosis: греч. osleon кость arthron сустав sis: синоним: артроз, генерализованный остеоартроз, разделы, остеоартроз Замыкает «тройку лидеров» поражение плечевого сустава в 11 всех ДОА. На долю поражений остальных Деформирующий остеоартроз плечевого сустава: диагностика и лечение. Код данного недуга по МКБ 10 М19. Расшифровка кода артропатии и другие артрозы. Другое название заболевания деформирующий артроз плечевого сустава. Назначается соответственное лечение. При этом для классификации болезни врачи используют код по МКБ 10. МКБ 10. Класс XIII. Болезни костно-мышечной системы и соединительной ткани. 2 Плечо Плечевая Локтевой сустав кость. M19 Другие артрозы код локализации см выше . Виды деформирующего остеоартроза (ДОА, Полиартрозу присвоен код M15- Деформирующий артроз плечевого сустава код мкб 10– ПРОДУКТИВНОСТЬ, которые являются синонимами согласно коду МКБ 10: деформирующий артроз

Лечение артроза (остеоартроза) методом УВТ

Х Международная классификация болезней (МКБ-10), принятая в 1989 году в Женеве Всемирной ассоциацией здравоохранения, систематизирует разнородную международную терминологию этого заболевания, указывая, что артроз, остеоартроз, деформирующий артроз, деформирующий остеоартроз (ДОА) являются синонимами и обозначают хроническое невоспалительное дегенеративно-дистрофическое заболевание суставов, в основе которого лежит разрушение суставной хрящевой ткани с последующей деформацией всего сустава: субхондральной кости, синовиальной сумки (капсулы), связок и периартикулярных мышц.

Виды остеоартроза

Остеоартроз может развиваться как самостоятельное заболевание, или как осложнение при других болезнях. В первом случае его чаще всего называют идеопатическим, или первичным остеоартрозом, так как истинная причина его развития остается неустановленной.

Во втором случае диагностируется основная причина заболевания, которой могут оказаться:

  • Травмы, врожденные дисплазии суставов и аномалии развития скелета
  • Заболевания обмена веществ (подагра, гемахроматоз, охроноз, болезни Вильсона и Гоше)
  • Эндокринные заболевания (сахарный диабет, акромегалия, гиперпаратиреоз, гипотиреоз)
  • Воспалительные процессы при системных аутоиммунных и инфекционных заболеваниях (ревматизм, красная волчанка, псориаз, опоясывающий лишай, туберкулез, сифилис, клещевой энцефалит, гнойное воспаление сустава)
  • Дегенеративно-некротические процессы (рассекающий остеохондрит, остеохондропатия головки бедренной кости)
  • Отложения солей тяжелых металлов и кальция (фосфаты кальция, гидроксиапатит)

Остеохондроз, вызванный вышеперечисленными причинами, называется вторичным.

Также это заболевание может поражать только один сустав — моноостеоартроз, или последовательно или одновременно несколько суставов — полиостеоартроз.

С точки зрения локализации в данном заболевании суставов можно выделить основные его виды:

  • Узелковый остеоартроз, или болезнь мелких суставов кисти рук
  • Остеоартроз первого плюснефалангового сустава стопы
  • Остеоартроз голеностопного сустава
  • Коксартроз, или остеоартроз тазобедренного сустава
  • Гонартроз, или остеоартроз коленного сустава
  • Проявления остеоартроза в других суставах

В качестве вторичного остеоартроза чаще всего встречается коксартроз и гонартроз — более половины всех случаев, к тому же это самые травмирующие виды заболевания. Первичной формой заболевания обычно является узелковый остеоартроз, который, предположительно, имеет генетическую природу и передается по женской линии.

Лечение остеоартроза

Лечение любых видов остеоартроза длительное и системное, оно включает набор классических принципов, среди них:

  • Ортопедический режим и разгрузка поврежденных суставов
  • Лечебная физкультура, благодаря которой поддерживается подвижность сустава, предотвращаются застойные явления, замедляются дегенеративные процессы
  • Различные виды физиотерапии: электромиостимуляции при ходьбе
  • Лечебный массаж и мануальная терапия
  • Внутримышечное или внутрисуставное введение препаратов НПВС — нестероидных противовоспалительных средств
  • Внутрисуставное введение гормональных глюкокортикостероидных средств
  • Полугодовой курс хондропротекторов – хондроитина сульфата и глюкозамина
  • Внутрисуставное введение препаратов гиалуроновой кислоты
  • Декомпрессия зоны метаэпифиза бедра или коленного сустава для снятия повышенного внутрикостного давления
  • Внутрисуставная озонотерапия для насыщения синовиальной жидкости кислородом и ускорения окислительных процессов
  • Бальнеология и грязелечение

И здесь следует отметить эффективность относительно нового для России метода ударно-волновой терапии, который основан на принципе сообщения суставу дозированных импульсов высокой энергии в виде инфразвуковых ударных волн, благодаря чему происходит «оживление» всех тканей сустава на клеточном уровне:

  • Ускоряется метаболизм
  • Происходит выведение токсинов из синовиальной жидкости
  • Разрушаются патологические костные новообразования в виде остеофитов
  • Улучшается питание хрящевой ткани и ее регенерация
  • Снимается болевой синдром
  • Восстанавливается микроциркуляция крови, а вместе с ней снимаются отеки и затормаживаются воспалительные процессы

МКБ-10, признаки разных стадий, лечение

Дистрофическая патология, при которой происходит разрушение хрящевой ткани и суставной поверхности, носит название деформирующего артроза.

Около 5% всего населения земного шара страдает от этого заболевания, протекающего достаточно прогрессивно. Развитие патологического процесса сопровождается нарушением функции и структуры сустава.

Этиология развития заболевания

В МКБ-10 деформирующему артрозу присвоен код М19. Заболеванию в большей степени подвержены пожилые люди, но в группу риска входит и молодежь 25-летнего возраста, работающая с тяжелыми физическими нагрузками, профессионально занимающаяся травмоопасными видами спорта или ведущая малоактивный образ жизни.

На начальном этапе поражению подвергаются суставные хрящи и поверхности костей. По мере развития патологии вовлекаются околосуставные мягкие ткани.

Чаще всего поражению подвергается коленный сустав – 75% всех случаев, реже – плечевой (не больше 15%). По мере старения и изнашивания сустава его хрящ истончается, снижается объем суставной жидкости, меняются ее физические параметры. Данные процессы могут происходить и в более молодом возрасте под влиянием определенных факторов.

С течением времени хрящевая структура разрушается, происходит сужение ее полости, а костная ткань начинает активно разрастаться.  Костям становится тесно, они начинают между собой тереться, деформируя при этом суставы. Те, в свою очередь, начинают терять эластичность и подвижность.

На фото изменения в пальцах при артрозе

Причины патологического состояния

Возникновению болезни в любом возрасте может поспособствовать влияние нескольких факторов. До настоящего времени истинное появление деформирующего артроза изучается и до конца не исследованы. В большинстве случаев заболевание развивается на фоне:

  1. Недостаточного обеспечения сустава питанием
  2. Получения травмы
  3. Врожденных патологий формирования позвоночника
  4. Заболеваний эндокринной системы
  5. Воспаления суставов (артрит)
  6. Неправильного питания
  7. Лишнего веса
  8. Частого переохлаждения организма

Не последнее значение в появлении артроза имеет и наследственный фактор. Располагающими факторами к появлению болезни могут быть также вредные привычки и малоподвижный образ жизни.

Любая постоянная нагрузка, особенно если ее распределение неравномерно, оказывает негативное воздействие на работу суставов и рано или поздно станет причиной появления проблем в их работе. У женщин деформирующая патология диагностируется чаще, чем у представителей сильного пола.

Степени развития болезни

Болезнь, поражающая сустав и вызывающая его деформацию, в своем развитии проходит несколько этапов. Принято разграничивать 3 основные:
  1. На начальном этапе ограничение движения на пораженном участке незначительно, патологические изменения видны только на рентгеновском снимке (костные наросты образуются на поверхности сустава по краям, вызывая незначительное заужение щели).
  2. На следующей стадии подвижность уменьшается. Движения больным суставом сопровождаются хрустом, начинается атрофия мышц. На рентгене можно рассмотреть уже большее число костных наростов – остеофитов.
  3. На завершающем этапе деформация суставной поверхности становится видимой. Подвижность его значительно ограничивается. На снимке видны свободно располагающие в суставной полости осколки костных образований. Щель полностью закрыта, имеются субхондральные кисты.

Некоторые специалисты также выделяют нулевую стадию болезни. В этом периоде, по их мнению, начинают происходить первые дегенеративные изменения. Но они проходят на клеточном уровне, поэтому клиническая картина течения болезни еще отсутствует.

Симптоматика

Симптоматика у патологии имеет нарастающий характер. Характерными признаками происходящей деформации суставов являются:
  • Боль (увеличивается во время нагрузки на сустав и пропадает без нее)
  • Скованность движений (особенно выражена в утренние часы)
  • Отечность тканей
  • Видимая деформация сустава
  • Появление в близлежащих мышцах мелких болезненных узелков
При поражении тазобедренного сустава болезнь протекает особенно тяжело: боли в паху отдают по всей длине ноги. сустав может полностью заклинить, вызывая гипотрофию ягодичных и бедренных мышц. У больного начинается хромота.

Классификация типов

В медицине выделяется классификация типов деформирующего артроза. Он может быть первичным (развивается самостоятельно) или вторичным (появляется на фоне имеющихся заболеваний суставов).

По месту локализации заболевание поражает следующие участки:

  • Коленный сустав
  • Стопу
  • Плечевой сустав
  • Тазобедренный сустав

При поражении каждого из участков симптоматика проявления может несколько отличаться. Одно для всех типов остается неизменным: больной состав ограничен в своей подвижности.

Колена

Происходящая в коленном суставе деформация называется гонартрозом. Острое воспаление сопровождается болевым синдромом, нарастающим по силе при ходьбе или нагрузках.

На ранних стадиях болезнь не проявляет себя, по мере развития пациент замечает «реакцию» сустава на погодные изменения, появление при движении скрипа или хруста в колене, покраснения и припухлости его поверхности.

По мере развития гонартроза боль будет только усиливаться, а дальнейшее передвижение будет практически невозможным без опоры.

Тазобедренного сустава

Деформация тазобедренных суставов в медицине называется коксартрозом. На патологию приходится четверть всех зарегистрированных случаев артроза. Обусловлено это тем, что на этот участок за время жизни и деятельности человека приходится больше всего нагрузок.

Симптоматическое проявление заболевания схожее с поражением суставов на других участках. Лечение на ранних стадиях проводится без операции.

Стопы

При поражении деформирующим артрозом суставов стопы о полном излечении болезни или службе в армии не может быть и речи.

Чаще всего заболевание заканчивается для пациента получением инвалидности. Общая клиническая картина симптомов аналогична гонартрозу. Дополнительным признаком недуга является выраженная деформация голеностопного сустава.

В профилактических мерах и в целях лечения больным рекомендуется носить ортопедическую обувь.

Плеча

Поражение сустава плечевого пояса называется омартрозом. Вызвано оно чаще всего травмированием. Патологическое состояние практически на отражается на трудоспособности, но заметна существенная деформация сустава.

Из всех типов артроза по месту локализации эта разновидность деформации является самой «безобидной». На ранних этапах быстро поддается лечению.

Кистей рук и пальцев

У женщин старше 40 лет чаще всего диагностируют деформирующий артроз пальцев и кистей рук.  У пожилых людей он выявляется в равной степени для обоих полов.

Характерным признаком деформации становятся узелки Бушара и Гебердена на руках. В основном они поражают боковую поверхность сустава.

С течением времени фаланги пальцев начинают искривляться. Кисти рук теряют прежнюю подвижность, в руках появляется пульсирующая боль.

По мере прогрессирования болезни происходит нарушение мелкой моторики пальцев. При полной неподвижности кистей пациент теряет работоспособность.

Постановка диагноза и обследование пациента

Для уточнения наличия деформирующего артроза больному, в первую очередь, делают рентгенографию. На ней будут видны произошедшие в суставах изменения.

По оценочной шкале симптомов дается тестовая суммарная оценка степени тяжести протекания болезни. Лабораторным исследованиям подвергаются кровь и моча.

По их результатам можно говорить о силе воспалительного процесса и наличии сопутствующих патологических состояний.

Оценка степени развития заболевания дается по шкале Лекена. При этом учитываются время и продолжительность болевого синдрома и скованность движений. На основании функциональности суставов ставится окончательное количество баллов по 10-бальной шкале.

При определении процентного соотношения проблем с функцией суставов устанавливается группа инвалидности.

Как лечить деформирующий артроз?

Терапия лечения подобного заболевания независимо от места локализации проходит сложно и занимает немало времени. При лечении важно:
  1. Во время обострения ограничить подвижность пораженных участков
  2. Предотвратить возникновение контрактур и ограничения функциональности сустава
  3. Снять болевой синдром
  4. Восстановить работу сустава
  5. Проводить профилактические мероприятия по предупреждению болезни

Для снятия боли используются лекарственные средства из группы кортикостероидов или нестероидных противовоспалительных препаратов. дальнейшее назначение лекарств направлено на устранение причины появления болезни.

Принципиально важными к приему являются хондропротекторы (Глюкозамин, Алфлутоп, Дона, Структум) и препараты с содержанием гиалуроновой кислоты (Ферматрон, Остенил, Дьюралан).

Наладить кровообращение в области поражения суставов и улучшить обменные процессы помогают физиотерапевтические процедуры. Применяемые методики весьма разнообразны, поэтому назначению делаются индивидуально для каждого пациента.

Восстановить подвижность суставов помогает лечебная физкультура. Занятия могут быть представлены аэробикой, механотерапией, водными упражнениями, ЛФК и массажем.

Упражнения для тазобедренного сустава

Опасность заболевания

Самым серьезным последствием деформирующего артроза является полная потеря подвижности сустава. Человек теряет работоспособность и получает группу инвалидности.

Прогноз

Лечение болезни на ранних стадиях имеет положительную динамику. Но пациенту следует быть готовым к тому, что терапия занимает много времени, на протяжении которого необходимо строго следовать всем врачебным рекомендациям.

Придется пить назначаемые лекарственные средства, проходить лечебные процедуры и придерживаться правильного образа жизни. В ряде случае может быть откорректирован и рацион питания больного.

Как лечат деформирующий артроз, смотрите в нашем видео: 

Деформации хондроцитов как функция нагрузки на тибиофеморальный сустав, прогнозируемая с помощью обобщенного высокопроизводительного конвейера многомасштабного моделирования

Abstract

Известно, что клетки опорно-двигательного аппарата реагируют на механическую нагрузку, и хондроциты в хрящах не являются исключением. Однако понимание того, как нагрузки на уровне суставов связаны с деформациями на уровне клеток, т.е. в хряще, не является простой задачей. В этом исследовании был реализован конвейер многомасштабного анализа для постобработки результатов макромасштабной модели конечного элемента (КЭ) большеберцово-бедренного сустава, чтобы обеспечить граничные условия смещения на основе механики сустава для микромасштабных клеточных КЭ-моделей хряща. с целью характеристики деформаций хондроцитов по отношению к нагрузке тибиофеморального сустава.Удалось определить распределение нагрузки внутри колена среди его тканевых структур и, в конечном счете, внутри хряща между его внеклеточным матриксом, перицеллюлярной средой и резидентными хондроцитами. Были рассчитаны различные показатели клеточной деформации (изменение соотношения сторон, объемная деформация, эффективная клеточная деформация и максимальная деформация сдвига). Чтобы проиллюстрировать дальнейшую полезность этого конвейера многомасштабного моделирования, были рассмотрены две микромасштабные конструкции хряща: идеализированная одиночная клетка в центре блока 100×100×100 мкм, обычно используемая в прошлых исследованиях, и анатомически основанная (11 клеточная модель того же объема) изображение средней зоны большеберцово-бедренного хряща. В обоих случаях хондроциты испытывали усиленные деформации по сравнению с таковыми в макромасштабе, что было предсказано путем моделирования сжимающей нагрузки в один вес тела на тибиофеморальный сустав. В случае с 11 ячейками все ячейки испытали меньшую деформацию, чем в случае с одной ячейкой, а также показали большую дисперсию деформации по сравнению с другими ячейками, находящимися в том же блоке. Метод соединения оказался хорошо масштабируемым благодаря независимости микромасштабной модели, что позволило использовать архитектуру вычислений с распределенной памятью.Обобщенный характер метода также допускает замену любой макро- и/или микромасштабной модели, обеспечивающей применение для других многомасштабных задач механики сплошной среды.

Образец цитирования: Sibole SC, Erdemir A (2012) Деформации хондроцитов как функция нагрузки на тибиофеморальный сустав, прогнозируемая с помощью обобщенного высокопроизводительного конвейера многомасштабных симуляций. ПЛОС ОДИН 7(5): е37538. https://doi.org/10.1371/journal.pone.0037538

Редактор: Хани А.Awad, Cleveland Clinic, Соединенные Штаты Америки

Получено: 18 ноября 2011 г.; Принято: 23 апреля 2012 г.; Опубликовано: 23 мая 2012 г.

Copyright: © 2012 Sibole, Erdemir. Это статья с открытым доступом, распространяемая в соответствии с лицензией Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания оригинального автора и источника.

Финансирование: Эта работа была поддержана грантом R01EB009643, предоставленным Национальным институтом биомедицинской визуализации и биоинженерии, Национальным институтом здоровья (http://www.nibib.nih.gov/). Спонсоры не участвовали в разработке исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы ознакомились с политикой журнала и имеют следующие конфликты: Ахмет Эрдемир владеет и управляет innodof, LLC, консалтинговой компанией по моделированию и моделированию. Скотт Сибол заявил, что конкурирующих интересов не существует. Это не меняет приверженности авторов всем политикам PLoS ONE в отношении обмена данными и материалами.

Введение

Феномен управления поведением клеток механическими раздражителями, называемый механотрансдукцией или механорегуляцией, а также повреждение клеток в результате механического разрушения, являются предметом исследований в медицине и биологии на протяжении нескольких десятилетий [1]–[ 3]. Часто исследования проводились в пространственном масштабе клетки и ее непосредственного внеклеточного окружения. В то время как клеточная активность на микроуровне изменяет механическую среду, нагрузка, передаваемая с более высоких пространственных масштабов, также играет роль [4].По этой причине поиск лучшего понимания многомасштабных пространственных взаимодействий становится все более желательной целью, чтобы установить причинно-следственные механические отношения между нагрузкой на суставы, ткани и клетки.

В области биомеханики существует сильная мотивация к лучшему пониманию механики суставного хряща [5]. Это связано с высокой распространенностью таких патологий, как остеоартрит (ОА), которым страдают около 27 миллионов взрослых в США [6] и который может резко снизить качество жизни.Прогрессирование ОА проявляется изменениями в структуре ткани [7]–[9], а также изменениями в клеточном (хондроцитном) распределении и поведении [10]–[14]. Хотя эти изменения происходят на тканевом или клеточном уровне, существует общее мнение, что нагрузка на суставы, вероятно, играет роль в их возникновении. Даже при отсутствии патологии хрящ может претерпевать изменения просто в результате старения. Как и при ОА, эти изменения происходят в тканевом [15], [16] и клеточном масштабе [17], [18]. Кроме того, при старении происходят модификации механики суставных масштабов [19]–[21].Ясно, что механика хряща представляет собой многомасштабную парадигму, и средства для исследования взаимодействия между масштабами имеют решающее значение для расширения понимания функции этого биологического материала in vivo.

В то время как патология и старение влияют на механику хряща в различных масштабах, прежде чем решать такие сложности, необходимо понять нормальное механическое поведение суставов, тканей и клеток. Экспериментальное получение механических данных, достижимое в исследованиях на животных [22], становится более трудным по мере уменьшения пространственного масштаба.Если кто-то попытается одновременно собрать данные в разных пространственных масштабах в реалистичных сценариях загрузки, например. синхронное измерение кинематики и/или кинетики на уровне суставов и деформации клеток, настоящая технология неадекватна. Методы компьютерного моделирования дают возможность получить дополнительные сведения о механике в различных пространственных масштабах. Кроме того, передача информации между моделями в разных пространственных масштабах позволяет исследовать механизмы передачи нагрузки.

В каждом из этих отдельных пространственных масштабов были проведены обширные исследования с использованием компьютерного моделирования, в частности анализа методом конечных элементов (FEA). В тканевом и клеточном масштабе сложные конститутивные модели применялись к упрощенным геометрическим и нагрузочным случаям [23]. Напротив, в масштабе сустава обычно использовались более простые модели материалов, что позволяло учитывать сложную геометрию и условия физиологической нагрузки [24]. В конечном счете, сопоставление моделей в обоих масштабах даст представление о механике, с которой хондроцит испытывает in vivo .

Для понимания механической связи между функцией суставов и реакцией хондроцитов можно использовать множество подходов.Явное моделирование компонентов микромасштаба в модели макромасштаба представляет собой метод с наименьшей абстракцией. Этот подход часто используется при моделировании губчатой ​​кости [25], но требует огромного количества конечных элементов даже для небольших объемов. Для размеров и дополнительных сложностей соединения вычислительные затраты слишком велики, учитывая современные технологии.

Вычислительная гомогенизация, при которой поведение материала в макромасштабе на каждом шаге нелинейного решения является результатом решения микромасштабной модели в каждой точке интегрирования в макромасштабной сетке, обеспечивает еще один путь для соотнесения пространственных весы [26]. Несмотря на то, что этот метод по-прежнему требует значительных вычислительных ресурсов, решения могут быть получены с помощью этого метода [27], но для сложных задач требуется доступ к большим архитектурам с общей памятью, которые менее распространены, чем платформы с распределенной памятью. Следует также отметить, что надежное моделирование с использованием этого метода может оказаться невозможным, поскольку сбой в сходимости одной микромасштабной модели, если она не содержится, приводит к сбою всего макромасштабного решения.

Наконец, можно использовать простой метод постобработки.Это включает в себя сначала получение решения макромасштабной модели, возможно, с использованием МКЭ. Деформация, испытываемая каждым конечным элементом в этой модели, затем может быть использована для создания граничных условий для массива моделей микромасштаба, которые затем решаются для определения отклика микромасштаба. Хотя это обеспечивает более слабую связь между шкалами, чем ранее описанные методы, и, следовательно, должно удовлетворять множеству предположений о согласованности между шкалами, это дает уникальное преимущество в том, что все модели независимы или автономны. Это позволяет использовать архитектуры с распределенной памятью, которые могут обеспечить огромную вычислительную мощность, поскольку нет необходимости передавать информацию между микромасштабными моделями. Кроме того, этот подход более надежен в том смысле, что сбой микромасштабной модели не приводит к сбою всего процесса. В то время как механика макромасштаба не является прямой функцией реакции микромасштаба (как при вычислительной гомогенизации), конвейер постобработки может предоставить экономичную платформу для описательного анализа деформаций клеток при различных нагрузках на суставы.

Подход к постобработке, чтобы связать механику суставов с клеточной механикой, был использован для достижения тройной цели в этом исследовании: i) установить конвейер для постобработки результатов макромасштабного анализа методом конечных элементов для оценки микромасштаба деформации клеток для желаемых макромасштабных областей в желаемый момент времени макромасштабной нагрузки, ii) чтобы проиллюстрировать полезность трубопровода посредством оценки деформаций клеток в хряще средней зоны для компрессионной нагрузки большеберцово-бедренного сустава, и iii) для изучения различия в результатах многомасштабного моделирования современных и анатомически обоснованных предположений о распределении клеток в микромасштабном объеме.

Методы

Автономный подход, реализованный в этом исследовании, включал ряд этапов, начиная с МКЭ единой макромасштабной модели в масштабе соединения, расчета градиентов деформации в центроидах элементов с использованием этих градиентов деформации для задания граничных условий для микромасштабные модели для каждого интересующего макромасштабного элемента и, наконец, параллельное решение и постобработка множества микромасштабных моделей (рис. 1).

Рис. 1. Выше показан автономный подход к соединению суставных, тканевых и клеточных чешуек.

Слева: метод начался с МКЭ макромасштабной модели для кинетического/кинематического сценария. Градиенты деформации в центроидах конечных элементов в интересующих областях ткани рассчитывали по узловым положениям элементов. Справа: граничные условия смещения были заданы узлам поверхности независимых микромасштабных моделей, соответствующих градиенту деформации каждого конечного элемента, испытывающего деформацию в рассматриваемых областях ткани. Результаты микромасштабных решений МКЭ были подвергнуты последующей обработке для расчета интересующих метрик деформации.

https://doi.org/10.1371/journal.pone.0037538.g001

Макромодель

Для получения макромасштабного решения использовалось бесплатное и открытое представление конечных элементов тибиофеморального сустава с измененными свойствами материала и граничными условиями (версия Open Knee 1.0.0) [28]. Были представлены большеберцовая кость, бедренная кость, медиальная коллатеральная связка (MCL), латеральная коллатеральная связка (LCL), передняя крестообразная связка (ACL), задняя крестообразная связка (PCL), медиальный и латеральный мениски, бедренный и большеберцовый хрящи (рис. 2А).Все структуры мягких тканей были дискретизированы с помощью 56433 линейных шестигранных (8 узлов) конечных элементов (рис. 3) и им были присвоены гиперупругие свойства материала, действительные для конечной деформации, на основе литературных значений (таблица 1), в то время как кости были дискретизированы с помощью 25220 четырехугольных элементов оболочки с толщиной и предполагается жестким.

Рис. 2. Макро- и микромодели, использованные в исследовании.

А . Модель большеберцово-бедренного сустава использовалась в макромасштабе.Для костей, смоделированных как твердые тела, были заданы граничные условия для аппроксимации сжимающей нагрузки сустава. Большеберцовая кость была зафиксирована в пространстве. Компрессию бедра назначали при фиксированном сгибании с неограниченными остальными степенями свободы. Б . Модели с одной (вверху) и 11 ячейками (внизу). Одноклеточная модель была популярным сценарием, рассмотренным в предыдущих исследованиях [39], в то время как 11-клеточная модель лучше представляла наблюдаемую плотность клеток in situ и для среднего слоя суставного хряща в колене [40].

https://doi.org/10.1371/journal.pone.0037538.g002

Рис. 3. Конечно-элементная модель большеберцово-бедренного сустава с представлением ПКС, ЗКС, ПКС, ЛКС, большеберцового и бедренного хрящей, латерального и медиального менисков , бедра и голени.

Структуры мягких тканей были дискретизированы с помощью 56433 линейных шестигранных конечных элементов со средней длиной ребра приблизительно . Кости были дискретизированы с помощью 25220 четырехугольных элементов оболочки с заданной толщиной .Увеличенная область модели показана справа, чтобы проиллюстрировать разрешение сетки. Бедренный и большеберцовый хрящи имели по 3 шестигранных элемента по толщине.

https://doi.org/10.1371/journal.pone.0037538.g003

Для определения суставного хряща использовалась несвязанная изотропная конститутивная модель Муни-Ривлина [29]. Параметры модели были заданы для согласования с литературными значениями мгновенного (при быстром нагружении) модуля упругости (10 МПа) [30] и для моделирования почти несжимаемой среды (коэффициент Пуассона 0.48) поведение (табл. 1). Связки [31]–[33] и мениски [34]–[36] моделировались как трансверсально-изотропные с основным веществом Муни-Ривлина и кусочно-нелинейным волокнистым членом [37] (табл. 1).

Был определен контакт без трения между всеми структурами мягких тканей, которые могут соприкасаться. Большеберцовая кость фиксировалась в пространстве на все время решения, а бедренной кости предписывалось дистальное (компрессионное) смещение линейно-наклонное с фиксированной флексией. Было предписано перемещение, а не сила, поскольку это была лучше численно обусловленная задача.Все остальные степени свободы бедренной кости были свободны, что позволяло определять траекторию бедренной кости за счет комбинированного воздействия структур мягких тканей. Неявный динамический анализ проводился с использованием FEBio версии 1.4 [38]. Динамическая модель использовалась для использования матрицы сосредоточенных масс, чтобы обусловить матрицу жесткости на каждом нелинейном временном шаге и помочь в сходимости модели. Деформированные узловые позиции были выходными данными макромасштабной модели, которые необходимо было обработать для многомасштабной связи.

Механическая муфта соединения шкалы с ячейкой

Механическая связь между пространственными масштабами была достигнута путем передачи градиентов деформации, возникающих на макроуровне, на микромасштаб. Градиент деформации представляет собой тензор второго порядка, который отображает вектор положения из недеформированного состояния в деформированное состояние . Недеформированные и деформированные узловые позиции из макромасштабной модели использовались для расчета градиентов деформации, возникающих в центроидах элементов для заданных пользователем наборов элементов в заданные пользователем моменты времени моделирования. Для текущего исследования сообщаемые результаты относятся к большеберцовому и бедренному хрящам при времени моделирования 0,00000000000. В этот конвергентный момент времени в моделировании возникала сжимающая сила приблизительно равная весу тела образца ().Последний сходящийся временной шаг в макромасштабной модели был , при котором возникала сжимающая сила . Таким образом, этот набор решений позволяет потенциально учитывать массу тела почти до экземпляра.

При расчете градиента деформации по деформированным узловым положениям использовался метод изопараметрической формулировки, часто применяемый в МКЭ. Вкратце, эта формулировка отображает элемент в глобальном пространстве в элемент идеализированной геометрии, где вычисления могут выполняться упрощенным способом.Для расчета градиента деформации в центроидах элементов были оценены следующие уравнения. (1) (2) (3)

где, – вектор положения центроида в идеализированном геометрическом пространстве, – векторы положения недеформированных узлов, – трилинейные функции формы узлов, – вектора положения деформированных узлов, – вектор положения элемента в глобальном пространстве, соответствующем точке в идеализированном пространстве , и – градиент деформации. Градиенты деформации, рассчитанные по уравнению 3, использовались для задания граничных условий для каждой модели микромасштаба.

Микромодели

Вводные карты микромасштабной модели для элементов, подвергшихся деформации (характеризующихся наличием градиента деформации, отличающегося от тензора идентичности больше, чем в любом компоненте). В общей сложности 7882 элемента большеберцового и бедренного хрящей превышали этот порог и требовали создания модели. Были рассмотрены два микромасштабных случая: одна ячейка и конфигурация с 11 ячейками (рис. 2B). В случае одиночной клетки рассматривалась сферическая клетка (радиусом ), окруженная перицеллюлярным матриксом (ПКМ) (толщиной ), расположенная в центре блока внеклеточного матрикса (ВКМ), аналогично предыдущим исследованиям [39].Для случая с 11 клетками клетки и ПКМ того же размера, что и конфигурация одной клетки, были случайным образом расположены в блоке ЕСМ с ограничением, что все хондроны (хондроцит + ПКМ) были разделены по крайней мере (эквивалентно толщине перицеллюлярного матрикса) и были по крайней мере от внешней границы. Одиннадцать клеток соответствовали среднему количеству клеток, встречающихся в блоке среднего слоя тибиофеморального суставного хряща такого размера [40]. Материалы были определены с помощью несвязанной конститутивной модели Муни-Ривлина со значениями из [41], скорректированными для приблизительного удовлетворения механической согласованности в пространственных масштабах (таблица 2). Это было достигнуто путем присвоения ECM, который составляет 99,5% и 94,2% объема конструкции для случаев с одной и 11 клетками, соответственно, идентичных свойствам хряща в макромасштабной модели. Предыдущие исследования показали, что PCM может оказывать эффект усиления/ослабления напряжения на клетку из-за несоответствия жесткости между ECM, PCM и клеткой [42]–[44]. Поэтому свойства ячейки и PCM были масштабированы для поддержания тех же соотношений, что и значения, указанные в [41].

Узлам на шести гранях блока ECM были заданы граничные условия смещения, полученные в результате применения макромасштабных градиентов деформации элементов, к их недеформированным векторам положения (уравнение 4).(4)

Модели микромасштаба были решены с использованием неявного статического анализа в FEBio версии 1.4. Для проверки было проведено исследование сходимости сетки для геометрии с одной ячейкой, подвергнутой номинальной деформации -30% в z-измерении со свободным боковым (x- и y-измерениями) граничными условиями расширения (другими словами, неограниченная одноосная нагрузка). Максимальная эффективная деформация и максимальная деформация сдвига, имевшие место в модели, изменились на 3,6% и 1,9% соответственно при увеличении сетки с 15168 до 25889 линейных шестигранных элементов.Поэтому предполагалось, что модель из 25889 элементов (рис. 4) является конвергентной по сетке. Модель 77880 шестигранных элементов 11-ячеечной геометрии считалась конвергентной по сетке, поскольку ячейки и ИКМ имели ту же плотность сетки, что и конвергентная одиночная ячейка, 9 элементов по диаметру ячейки и 2 элемента по толщине ИКМ, а ECM имел более высокую плотность.

Рис. 4. Поперечное сечение сетки конечных элементов 25889 для одноячеечного микромасштабного случая, который был определен как сходящийся по сетке.

Внеклеточный матрикс (ECM), перицеллюлярный матрикс (PCM) и хондроцит (Cell) были разделены линейными шестигранными элементами. Хондроцит имел 9 элементов по диаметру, а перицеллюлярный матрикс — 2 элемента по толщине. В случае с одиннадцатью клетками хондроциты и перицеллюлярный матрикс имели одинаковую плотность сетки.

https://doi.org/10.1371/journal.pone.0037538.g004

Анализ деформации микромасштабной модели

Для количественной оценки деформации ячеек в микромасштабных моделях для ячейки были рассчитаны усредненная по объему эффективная (по Мизесу) деформация, эффективное напряжение и максимальная сдвиговая деформация, а также начальное и деформированное соотношения сторон по формуле операции над тензорами напряжений и деформаций, сгенерированные модельным моделированием для каждого элемента.Метрики деформации на уровне ячеек требовали усреднения объема по ячейке. Недеформированные () и деформированные () объемы элементов внутри ячеек использовались для усреднения объема. Объемы недеформированных элементов определялись по узловым положениям, считанным из файла определения сетки микромасштаба. Аналогичным образом, деформированные узловые положения, результат недеформированных узловых положений плюс вектор узлового смещения, использовались для расчета объемов деформированного элемента. Файл определения сетки также содержал наборы элементов, которые использовались для определения субрегионов микромасштаба, например.грамм. ячейка (ячейки). Объем каждого элемента в сетке был рассчитан по уравнению 5, (5), где были оценены матрицы Якоби в центроиде каждого элемента (определяющими факторами которых были отношения объемов) и были изопараметрические объемы элементов. Для шестигранного случая изопараметрический элемент был определен как куб (с теми же единицами измерения, что и единицы модели), поэтому всегда был равен . Матрица Якоби отображает изопараметрическое пространство в глобальное или модельное пространство . Объем элемента был рассчитан таким образом как для деформированного, так и для недеформированного случая.

Изменение объема ячейки.

Объемную деформацию для каждой клетки рассчитывали по уравнению 6.(6)

где – недеформированный объем элемента в ячейке.

Изменение соотношения сторон сотовой связи.

Форма (формы) ячейки (ячеек) была рассчитана путем сборки тензора момента инерции для конечных элементов, содержащихся в клеточных подмножествах. При допущении единичной плотности момент тензора инерции был рассчитан по уравнению 7,(7), где каждый конечный элемент принадлежал набору ячеек, был объемом элемента, , , и были компоненты элемента вектор положения центроида.

Собственные значения в порядке убывания этого тензора соответствуют главным моментам инерции, которые могут быть связаны с длиной осей эллипсоида, наиболее подходящего для формы объекта, с помощью уравнения 8 [45]. (8)

Были измерены три соотношения сторон: , , и , отношения большой-малой, большой-средней и средней-малой осей соответственно. Затем изменение соотношения размеров ячеек принимали за разницу между соотношениями размеров недеформированных и деформированных клеток.

Показатели напряжения и деформации.

Эффективное напряжение и деформация были положительно определенными скалярными значениями, рассчитанными из тензоров напряжений Коши и деформаций Грина-Лагранжа по уравнению 9,(9), где – собственные значения тензора напряжений или деформаций в порядке убывания. Эти собственные значения соответствуют главным напряжениям или деформациям.

Аналогично, максимальная сдвиговая деформация, рассчитанная по уравнению 10, также была положительно определенной и скалярной.(10)

Поскольку эти метрики были положительно определенными скалярами, усреднение по объему было допустимо для набора конечных элементов.Это было выполнено для ячейки (ячеек), PCM и ECM следующим образом: (11) где и были метриками деформированного объема и напряжения или деформации для каждого конечного элемента, содержащегося в соответствующем наборе.

Распараллеливание

Поскольку все микромодели были независимыми; их генерация, решение и анализ могут быть легко выполнены на вычислительной платформе с распределенной памятью. Все микромасштабные вычислительные работы для этого исследования были выполнены на кластере Glenn суперкомпьютерного центра Огайо (http://www.osc.edu), который обеспечивает до 9572 вычислительных ядер с частотами от 2,4 до 2,6 ГГц, предлагая пиковую производительность более 75 терафлопс. Набор сценариев Python и оболочки использовался для создания, решения с помощью FEBio и анализа уникальной микромасштабной модели для каждого конечного элемента, подвергающегося деформации в среднем слое большеберцового и бедренного хрящей. Процессы генерации, решения и анализа 7882 моделей были разделены между 101 вычислительным потоком, при этом 78 наборов процессов выполнялись последовательно в 100 потоках и 82 — в 101-м потоке.Конвейер был завершен по настенным часам примерно за 2 часа для случая с одной ячейкой и 19 часов для случая с 11 ячейками. Это соответствует времени процессора примерно 8,4 и 72,3 дня соответственно; демонстрируя важность параллелизма.

Результаты

Решение FEA модели большеберцово-бедренного сустава при 1-кратном сжатии от веса тела (1) привело к распределению деформации с концентрацией под границами мениска-хряща как для большеберцового, так и для бедренного хрящей (рис. 5A).Ячейка (ячейки) как в модели с одной ячейкой, так и в модели с 11 ячейками испытала усиленную деформацию по сравнению с деформацией конечного элемента макромасштаба, которая приводила в действие механику внешней модели микромасштаба. Этого можно было ожидать из-за большого несоответствия свойств материала компонентов микромасштаба, т.е. клетки были мягче, чем окружающая их среда, что приводило к неоднородной деформации, происходящей внутри. Хотя величины были разными, региональное распределение деформации было похоже на то, что произошло в макромасштабе (рис. 5B и 5C).

Рис. 5. Краевые графики, показывающие макро- и микромасштабные метрические региональные распределения деформации в среднем слое хряща бедренной кости (слева) и большеберцовой кости (справа).

А . Эффективная деформация, возникшая в макромасштабе. Б . Изменение соотношения размеров ячеек (основной-незначительный), рассчитанное для модели с одной ячейкой. С . Максимальное изменение соотношения размеров клеток (большой-минорный), испытываемое ячейкой в ​​модели с 11 ячейками.

https://дои.org/10.1371/journal.pone.0037538.g005

Изменение отношения размеров клеток, , было линейно пропорционально эффективному напряжению в макромасштабе как для случая с одной клеткой, так и для случая с 11 ячейками, при этом случай с 11 ячейками последовательно ниже для всех ячеек, чем в случае с одной ячейкой (рис. 6). В обеих конфигурациях разброс данных увеличивался по мере увеличения соответствующей макромасштабной деформации, при этом эффект усиливался в случае с 11 ячейками. Это поведение можно количественно оценить, рассмотрев сумму квадратов невязок (SSR), полученных для линейных подгонок.Большее значение SSR указывает на больший разброс (таблица 3).

Рисунок 6. Изменение отношения размеров ячеек, измеренное в каждой микромасштабной модели для случаев с одной ячейкой (слева) и 11 ячейками (справа), было построено как функция макромасштабной эффективной деформации, возникающей в соответствующем конечном элементе.

Сплошные линии представляли собой линейную регрессию методом наименьших квадратов, выполненную с требованием, чтобы линии проходили через начало координат. Наклоны каждой из этих линий были указаны в легенде.В случае с 11 ячейками строка с пометкой «Макс» учитывала только данные из ячейки, в которой произошло наибольшее изменение соотношения сторон. Аналогичным образом, строка с надписью «Мин. » представляла собой ячейку с наименьшим изменением соотношения сторон, а «Сред.» представляло собой среднее значение линейной регрессии для всех 11 ячеек. Эти наклоны указывали на то, что распределение изменения соотношения сторон по 11 ячейкам было смещено влево.

https://doi.org/10.1371/journal.pone.0037538.g006

Независимо от представления результатов в виде линейных зависимостей между макромасштабом и микромасштабом, микромасштабные решения имели неоднородную деформацию распространение внутри.Это представляло особый интерес при сравнении конфигураций с одной и 11 ячейками, где близость ячеек изменяла распределение в моделях с 11 ячейками (рис. 7). Более подробный взгляд на показатели деформации клеток для этого конкретного случая макроскопической деформации также показал, что величины деформаций отдельных клеток могут различаться, возможно, в зависимости от их местоположения (таблица 4). Как описано в методах, показатели деформации также были получены для ECM и PCM. Эти результаты, хотя и не представлены, могут быть полезны при исследовании механизмов повреждения матрикса.

Рис. 7. Пример распределения внутренних эффективных деформаций, наблюдаемых в одном (вверху справа) и 11-ячеечном (внизу справа) решении микромасштаба для одного и того же градиента деформации, переданного из макромасштаба (слева).

Конечный элемент макромасштаба подвергся комбинированному градиенту деформации при нагрузке, что привело к изменению формы с серого куба на синий шестигранник, показанный слева. Модели с одной и 11 ячейками были деформированы таким же образом, что и привело к эффективному распределению деформации в поперечном сечении модели, показанной справа.В то время как клетки испытали качественно сходные напряжения в обоих случаях, напряжение в ECM вокруг клеток в 11-клеточной модели отличалось от одиночной клетки в областях, близких к клеткам. См. Таблицу 4 для количественных результатов для конкретных клеток.

https://doi. org/10.1371/journal.pone.0037538.g007

Обсуждение

Метод, использованный в этом исследовании, был предварительным шагом к реализации связи механики суставного уровня с механикой клеточной среды.Хотя аналогичный метод использовался для упрощенной геометрии тканей в небольшом подмножестве пространственных координат [46], насколько известно авторам, это было первое исследование, в котором изучались большие области ткани и учитывалась анатомическая геометрия (как на макро- и микромасштабах). Это дало грубое представление о том, как клетки могут деформироваться in situ .

Некоторые важные наблюдения были сделаны при сравнении одноклеточных и 11-клеточных микромасштабных моделей. В обоих случаях деформации, определенные на макроуровне, применительно к микромасштабу приводили к усилению деформации клетки(ей).Такое поведение было ожидаемым, потому что хондроциты были намного мягче, чем окружающий внеклеточный матрикс. Однако каждая ячейка в модели с 11 ячейками испытывала меньшие деформации для данной деформации макромасштаба, чем в модели с одной ячейкой. Если рассмотреть простую одномерную аналогию последовательных пружин для моделирования композитов ECM-хондрона, то добавление большего количества мягких пружин, как в случае с 11-ячеечной моделью, приведет к меньшему смещению, происходящему в каждой из мягких пружин при смещении. прописывается на концах ряда.Расширение этого до 3D поддерживает результаты модели. Эта тенденция защиты от деформации в моделях с 11 ячейками может свидетельствовать о том, что случай с одной ячейкой обеспечивает верхнюю границу наблюдаемого усиления макро-микро деформации. Ячейки в 11 клеточных моделях также испытали различную деформацию друг от друга. Хотя положения клеток были назначены случайным образом для этой модели без каких-либо данных гистологического наблюдения, кроме подсчета клеток, можно предположить, что в действительности клетки в среднем слое хряща не подвергаются такому же механическому воздействию, и разрешение этой дисперсии может быть порядка нескольких микрон.Близость хондроцитов друг к другу могла определять их механику. Хотя анализ специально не проводился для изучения взаимосвязи между расстоянием между клетками и межклеточным механическим взаимодействием; это исследование с помощью показателей макро- и микроответа (рис. 6), подкрепленное сравнением результатов одно- и 11-клеточной модели для конкретной макроскопической деформации (рис. 7 и таблица 4), указывает на то, что такое влияние может существовать. Это, безусловно, важный вопрос для решения в будущем, когда может потребоваться оценка механики отдельных клеток в большой группе.

Несмотря на использование упрощенной геометрии (в микромасштабе) и конститутивных моделей (т. е. нелинейной, изотропно-упругой, а не анизотропной, пороупругой), это исследование предоставило возможность сделать несколько наблюдений с механо-биологической точки зрения. Показано, что удлинение клеток на 10 % вызывает катаболические процессы в хондроцитоподобных клетках SW1353, а на 5 % эффект отсутствует [47]. Эти удлинения соответствуют изменениям соотношения сторон (большие-второстепенные), равным примерно 0.154 и 0,024 соответственно. Учитывая низкую силу сжатия бедренной кости от массы тела, указанную в этом исследовании, по сравнению с массой тела или большими дистальными силами сустава, обычно наблюдаемыми при ходьбе [48], можно было бы не ожидать возникновения клеточных деформаций, которые могут вызвать катаболические процессы, но изменения в соотношениях сторон больше 0,154. Это указывало на ограничение моделирования в макро-, микро- или, вероятно, в обоих случаях, потенциально связанное с пригодностью макро- и/или микро-масштабных представлений материала.

Моделирование поведения материала макроскопического хряща как слишком мягкого было бы очевидным источником завышенного прогноза деформации. Если это имеет место в данном исследовании, прогнозируемые макромасштабные деформации хряща, необходимые для уравновешивания желаемого уровня нагрузки на сустав, будут больше, чем ожидалось. Это, в свою очередь, приведет к более высоким деформациям хондроцитов. Точно так же регулировка жесткости PCM и ячеек также окажет сильное влияние на деформацию ячеек.Свойства материала, присвоенные ECM, PCM и ячейке, были взяты из численного исследования, которое оптимизировало модуль PCM для согласования с экспериментальными наблюдениями. Оптимизированный модуль PCM, найденный в этом исследовании, привел к соотношению 2,11 (клетки/ECM) эффективной деформации, которое отличалось от экспериментально наблюдаемого соотношения на 0,5% [41]. Для текущего исследования оптимизированные свойства материала, описанные в [41], были масштабированы при сохранении тех же соотношений, и был рассмотрен случай нескольких ячеек.Чтобы оценить потенциальные источники ошибок из-за этого масштабирования, было проведено простое исследование чувствительности, в котором одиннадцатиклеточная модель подвергалась номинальной деформации сжатия 10% с сохранением объема бокового расширения для существенно различных свойств ECM: 1), [41 ], 2) , [отчет об исследовании], 3) , [отчет об исследовании × 10]) при сохранении эквивалентных соотношений жесткости между компонентами. Кроме того, был рассмотрен случай, в котором жесткость PCM, указанная в таблице 2, была уменьшена в 10 раз, 4) , , в то время как другие компоненты не изменились.Квартильный анализ отношений средней эффективной деформации, возникающей в ВКМ, к той, которая возникает в каждой ячейке для этих четырех случаев, представлен на рисунке 8. Масштабирование свойств материала от описанных в [41] до тех, которые использовались в этом исследовании. привели к небольшим изменениям в клеточной деформации, что указывает на то, что подход масштабирования не обязательно влиял на усиление макромасштабных напряжений в клетках. Аналогичным образом, масштабирование свойств материала с дополнительным коэффициентом 10 привело к незначительным изменениям.Напротив, снижение жесткости ПКМ в десять раз привело к снижению эффективной деформации клеток, что согласуется с тенденциями, наблюдаемыми в [41].

Рис. 8. Квартильный анализ отношений средней эффективной деформации клеток к эффективной деформации внеклеточного матрикса (ECM) для четырех случаев, рассмотренных в исследовании чувствительности к материалам 11-клеточной модели, показан выше.

В соответствии с [41], масштабирование свойств материала при сохранении соотношения (исследование и исследование ×10) не сильно влияет на деформацию хондроцитов, но изменяет соотношение жесткости между компонентами микромасштаба, т.е.е. за счет снижения жесткости перицеллюлярного матрикса в десять раз (исследование PCM/10).

https://doi.org/10.1371/journal.pone.0037538.g008

Для получения информативных результатов вычислительные модели в идеале должны использовать анатомическую геометрию, реалистичные конститутивные представления и физиологическую нагрузку на суставы. Кроме того, результаты моделирования должны быть подтверждены сравнениями с экспериментальными исследованиями. Это исследование обеспечило адекватное представление анатомии как на суставном, так и на клеточном уровне.Использование конститутивных моделей, которые охватывают анизотропное, пластинчатое и пороэластичное поведение хряща на макроуровне, вероятно, изменит распределение и величину деформации в ткани. В то время как эти сложные материальные модели обычно использовались в микромасштабе [23], их появление в объединенном масштабе произошло совсем недавно. Эти современные модели суставов требуют больших вычислительных затрат и в настоящее время способны моделировать только нагрузки, меньшие, чем наблюдаемые in vivo [49], а также меньшие, чем силы, использованные в этом исследовании.В дополнение к материальным допущениям, условия нагрузки, использованные в этом исследовании, хотя и были большими по величине, не обязательно были физиологическими, т.е. репрезентативными для походки. Существуют масштабные модели суставов, управляемые физиологической динамикой, но они должны использовать упрощенные модели материалов, подобные тем, которые использовались в этом исследовании, и возвращаться к явному интегрированию времени для скорости и надежности [50]. Крайне нелинейное поведение хряща при точном моделировании может лучше подходить для неявной временной интеграции и проверки сходимости нелинейного решения, которую оно обеспечивает.В настоящее время, даже в одном пространственном масштабе суставов, моделирование и симуляционные исследования, использующие как физиологически точное конститутивное поведение, так и реалистичную нагрузку, по-видимому, недоступны.

Рис. 9. Усредненная по объему максимальная деформация сдвига (слева) и объемная деформация (справа) для модели с 11 ячейками в зависимости от эффективной деформации в макромасштабе.

Показатели деформации, подобные показанным здесь, могут иметь дополнительные значения для понимания механизмов клеточного повреждения, а также начала механобиологической функции, которая может не обеспечиваться изменением соотношения сторон.Например, чистое расширение клеток приведет к объемной деформации, но не к изменению соотношения сторон. Большой диапазон объемной деформации также предполагает, что прямая линейная зависимость между макро- и микромасштабами может быть неприемлема для всех характеристик деформации.

https://doi.org/10.1371/journal.pone.0037538.g009

Как и в любом исследовании моделирования, необходимы проверка и проверка. Микромасштабные модели были проверены с помощью исследования сходимости сетки, но не были подтверждены экспериментальным исследованием.Напротив, исследование конвергенции сетки не проводилось на модели макромасштаба. Тем не менее, предыдущее исследование показало, что большеберцовый и бедренный хрящи, смоделированные с помощью упругих свойств материала, сходятся с приблизительной длиной ребра линейного шестигранного элемента [51]. Таким образом, хрящевая сетка, используемая в этом исследовании, с приблизительной длиной ребра элемента, равной 100 мм, считалась достаточной для анализа эластичности. Адекватная проверка биологических структур в любом масштабе; суставной, тканевой или клеточной, представляет собой существенную проблему.Кроме того, дальнейшее усложнение многомасштабной связи усугубляет трудности. Макромасштабная модель была слабо подтверждена путем оценки ее способности воспроизводить экспериментально наблюдаемую кинематику сустава [52], но этого уровня проверки в конечном итоге было недостаточно для аспектов этого исследования, которые зависели от распределения деформации в ткани, а не кинематика соединения. Контактное давление, которое может лучше отражать состояние внутренней деформации, является достижимой мерой [53], но в дополнение к дополнительным экспериментальным трудностям введение измерительных устройств может изменить механику соединения.Прогнозы больших деформаций хондроцитов при одной массе тела предполагают, что может потребоваться дальнейшая проверка стратегии многомасштабного моделирования. Хотя прямая проверка для подтверждения деформации хондроцитов в коленном суставе человека при физиологической нагрузке может оказаться невозможной; недавние исследования на животных могут дать возможные пути для установления уверенности в многомасштабном подходе к моделированию, представленном в этом исследовании. Например, недавнее применение многофотонной конфокальной микроскопии количественно определило деформацию хондроцитов in situ , в то время как интактный сустав мыши подвергался физиологической мышечной нагрузке [22].

Изменение соотношения сторон часто используется в качестве метрики для оценки деформации в экспериментах [45]. Тем не менее, другие представляющие интерес переменные, такие как связанные со сдвигом и объемной деформацией, могут иметь важное значение для понимания механизмов повреждения клеток, а также порогов механобиологической функции. Этот конвейер моделирования имеет возможность суммировать такие переменные, как показано на рисунке 9, показывающем объемную деформацию ячеек и максимальную деформацию сдвига, проявляемую ячейками модели одиннадцати ячеек.

Это исследование также предоставило большую базу данных взаимосвязей между входом и выходом между макро- и микромасштабной механикой. Наклоны, полученные в результате линейного регрессионного анализа этих данных, обеспечивают константу прямой пропорциональности, чтобы связать механику, полученную в макромасштабе, с деформацией, которую могут испытать хондроциты, с неопределенностью в этой взаимосвязи, количественно определяемой остатками подгонки. Кроме того, эта база данных содержала состояния нагрузки, которые были прямым результатом совместной механики.В то время как аналогичная база данных может быть получена либо с помощью идеализированного интервального шага по серии градиентов деформации, либо путем решения стохастического набора граничных условий с применением градиента деформации, первое может не охватывать все состояния нагружения, которые могут возникнуть, в то время как второе может ввести состояния, которые не могут возникнуть in situ . Эта база данных была специфична для случая вертикального сжатия на уровне суставов с массой тела 1×. Это может быть повторено для другого совместного сценария i.е. восхождение по лестнице, чтобы получить другую базу данных, относящуюся к конкретному виду деятельности. Коллекция этих баз данных может предоставить широко применимую суррогатную модель, т. е. аналогичную подходам, используемым при объединении моделирования движения и деформации ткани [54], для эффективного сопоставления механики макро- и микромасштаба без необходимости проведения микромасштабного анализа.

Рис. 10. Чтобы исследовать потенциальную ошибку, связанную с выборкой градиента деформации в центроидах элемента, были решены 11-ячеечные модели микромасштаба для восьми точек интегрирования по Гауссу макроэлемента, которые, как определено, имеют наибольшее изменение градиента деформации.

А . Градиенты деформации были рассчитаны в восьми точках интегрирования элемента макромасштаба ID 20585. B . Граничные условия микромасштабной модели, назначенные для каждой точки интегрирования и идентифицированные в последовательности изображений, привели к ряду деформаций. С . Изменение градиента деформации, связанное с выборкой точек интегрирования, привело к изменению показателей клеточной деформации. Квартильный анализ результирующего усредненного по объему эффективного напряжения клеток и изменения отношения размеров клеток показан выше со значением, определенным из анализа, проведенного в центроиде элемента макромасштаба, с наложением.

https://doi.org/10.1371/journal.pone.0037538.g010

Было доказано, что разработанный конвейер хорошо масштабируется, что позволяет достаточно быстро решать многомасштабную проблему. Поскольку итерационные многомасштабные коммуникации не требовались на этапах обработки и анализа многих микромасштабных симуляций, накладные расходы сети включали только перемещение файлов к каждому параллельному узлу и от него в начале и в конце генерации, решения и анализа. обработать.Поэтому было справедливо предположить, что этот метод, хотя и протестирован на 101 параллельном потоке, должен хорошо масштабироваться до тысяч потоков. Эта масштабируемость окажется бесценной при рассмотрении более сложных микромасштабных моделей или большего количества макроэлементов.

Только передача градиента деформации в макромасштабных центроидах конечных элементов потенциально может привести к ошибке. Шестигранный конечный элемент может деформироваться так, что градиент деформации будет неравномерным по его объему.В зависимости от режима нагрузки эта вариация может быть высокой, и выборка только в центроидах элементов макромасштаба может накладываться на деформацию, происходящую в континууме, дискретизированном конечными элементами. Чтобы оценить эту ошибку выборки, градиенты деформации были рассчитаны в каждой из 8 гауссовых точек интегрирования в конечных элементах макромасштаба. Затем изменение градиента деформации для каждого элемента было охарактеризовано путем взятия разности каждой уникальной комбинации 8 тензоров градиента деформации, суммирования абсолютного значения компонентов тензора, полученного в результате каждой разности, для получения скалярного остаточного значения, а затем взятие наибольшего из этих 8 скалярных невязок и использовать их в качестве метрики для описания изменения градиента деформации на конкретном элементе.Градиенты деформации, рассчитанные для элемента с самой высокой метрикой вариации, идентификатор элемента 20585 с остатком 0,317 (рис. 10А), использовались для назначения граничных условий восьми различным микромасштабным моделям с одиннадцатью ячейками (рис. 10В). Режимы деформации варьировались от доминирования сжатия, т.е. точка интеграции 3, чтобы преобладать сдвиг, например. точка интеграции 5. Показатели клеточной деформации были рассчитаны по результатам этих 8 моделей для каждого хондроцита, и был проведен квартильный анализ для каждой клетки (фиг. 10C).Диапазон результирующих метрик клеточной деформации высок, например. 30% в эффективной деформации. Хотя это элемент наихудшего случая, он определенно иллюстрирует чувствительность к пространственной выборке. Чтобы уменьшить эту ошибку, можно либо увеличить разрешение пространственной выборки, т.е. производить выборку в точках интегрирования, а не в центроидах, или уточнять сетку макромасштаба. Оба случая могут быть легко реализованы в этом подходе, с принятием дополнительных вычислительных затрат.

Задание граничных условий на основе градиента деформации смоделировало конечную деформацию в виде ряда Тейлора первого порядка.Для задач с крайне неравномерным градиентом деформации это может быть неадекватным приближением. Включение дополнительного члена в ряд будет охватывать градиент градиента деформации и, следовательно, включать информацию о том, как градиент деформации изменяется в пространстве [26]. С точки зрения времени, информация о деформации в макромасштабе передавалась в микромасштаб только в один момент времени. Временная история деформации элемента макромасштаба до этого момента не сообщалась.Хотя это не относится к анализу упругости, включение этой информации будет необходимо при рассмотрении зависящих от скорости явлений, таких как поро- или вязкоупругость.

Механическая согласованность в пространственных масштабах была удовлетворена в слабом смысле за счет использования одних и тех же конститутивных моделей на макро- и микромасштабах. PCM и клетка (ячейки), хотя и намного мягче, были незначительны по объему по сравнению с ECM. Ошибка, связанная с этим допущением, отсутствовала бы при использовании подхода вычислительной гомогенизации, в котором поведение материала на макроуровне было бы результатом определяющих моделей на микроуровне.Однако считалось, что преимущество вычислительной масштабируемости, обеспечиваемое используемым методом, перевешивает недостатки в удовлетворении механической непротиворечивости. Благодаря достижениям в технологии платформ с общей памятью подход к гомогенизации вычислений может быть пересмотрен в будущем.

Из-за того, что представленное исследование находится в зачаточном состоянии, в будущем этот подход может быть расширен множеством расширений. Рассмотрение более сложного поведения материалов на макро- и микромасштабах должно не только улучшить предсказуемость конвейера моделирования, но также позволит более точно исследовать механо-биологические процессы.Что касается прогнозирования, грубая линейная зависимость, представленная в этом исследовании для эластичных деформаций хондроцитов и нагрузки на суставы, может принимать более сложные формы при более точном конститутивном моделировании. Расширение пороупругой модели предоставит векторное поле потока жидкости, обеспечивающее понимание объемного потока жидкости для переноса питательных веществ, отходов и сигнальных агентов. Было показано, что хондроциты реагируют на напряжение сдвига жидкости в клеточной мембране [55], но не на гидростатическое давление, действующее нормально к ней [56], [57].Векторное поле потока жидкости, возвращенное пороупругой моделью, позволит количественно измерить эти поперечные и перпендикулярные величины. Точно так же включение волокнистых структур в материальные модели микромасштабных компонентов также будет иметь механо-биологические последствия. Такие добавления обеспечивают грубые средства для моделирования, например, взаимодействия фибрилл цитоскелета с сайтами связывания интегрина [4] и индуцированной растяжением активации ионных каналов [56], [57]. Также возможна дополнительная связь с механобиологическими моделями, обеспечивающая связь между повседневной активностью и такими явлениями, как ремоделирование матрикса, миграция клеток и апоптоз [58].В конечном итоге это поможет понять патологическую и/или возрастную эволюцию анатомии, физиологии и механики хряща.

Вклад авторов

Задумал и спроектировал эксперименты: АЭ СКС. Проведены эксперименты: СКС. Проанализированы данные: SCS AE. Предоставленные реагенты/материалы/инструменты анализа: SCS AE. Написал статью: SCS AE. Разработанные модели: SCS AE. Запустил симуляции: SCS. Интерпретированные результаты: SCS AE.

Каталожные номера

  1. 1.Wang JHC, Thampatty BP (2006) Вводный обзор клеточной механобиологии. Биомеханика и моделирование в механобиологии 5: 1–16.
  2. 2. Шварц М.А. (2010)Интегрины и внеклеточный матрикс в механотрансдукции. Перспективы Колд-Спринг-Харбор в биологии 2: a005066.
  3. 3. Колахи К.С., Мофрад МРК (2010)Механотрансдукция: основной регулятор гомеостаза и развития. Междисциплинарные обзоры Wiley, системная биология и медицина, 2: 625–639.
  4. 4. Chen CS, Ingber DE (1999) Тенсегрити и механорегуляция: от скелета к цитоскелету. Остеоартрит и хрящ / OARS, Общество исследования остеоартрита 7: 81–94.
  5. 5. Herzog W, Federico S (2006) Рассмотрение механики суставов и суставных хрящей. Биомеханика и моделирование в механобиологии 5: 64–81.
  6. 6. Лоуренс Р.К., Фелсон Д.Т., Хелмик К.Г., Арнольд Л.М., Чой Х. и др. (2008) Оценки распространенности артрита и других ревматических состояний в США.Часть II. Артрит и ревматизм 58: 26–35.
  7. 7. Притцкер К., Гей С., Хименес С., Остергаард К., Пеллетье Дж. и др. (2006)Гистопатология хряща остеоартрита: классификация и постановка. Остеоартрит и хрящи 14: 13–29.
  8. 8. Alexopoulos LG, Haider MA, Vail TP, Guilak F (2003)Изменения механических свойств перицеллюлярного матрикса хондроцитов человека при остеоартрите. Журнал биомеханической инженерии 125: 323–333.
  9. 9.Heinegrd D, Saxne T (2011)Роль хрящевой матрицы при остеоартрите. Nature Reviews Rheumatology 7: 50–56.
  10. 10. Ryu J, Treadwell BV, Mankin HJ (1984)Биохимические и метаболические нарушения в нормальном и остеоартритном суставном хряще человека. Артрит и ревматизм 27: 49–57.
  11. 11. Kim HA, Lee YJ, Seong SC, Choe KW, Song YW (2000)Апоптотическая гибель хондроцитов при остеоартрите человека. Журнал ревматологии 27: 455–462.
  12. 12. Meachim G, Collins DH (1962) Подсчет клеток нормального и остеоартритного суставного хряща в зависимости от поглощения сульфата (35SO4) in vitro. Анналы ревматических болезней 21: 45–50.
  13. 13. Yutani Y, Yamano Y (1996)Распределение дифференцированных фенотипов хондроцитов при остеоартрите коленного сустава. Городской медицинский журнал Осаки 42: 37–44.
  14. 14. Donkelaar CC, Wilson W (2011)Механика гипертрофии хондроцитов.Биомеханика и моделирование в механобиологии: В печати.
  15. 15. Hudelmaier M, Glaser C, Hohe J, Englmeier KH, Reiser M, et al. (2001) Возрастные изменения морфологии и деформационного поведения хряща коленного сустава. Артрит и ревматизм 44: 2556–2561.
  16. 16. Шарлебуа М., Макки М.Д., Бушманн М.Д. (2004)Нелинейные свойства растяжения бычьего суставного хряща и их изменение с возрастом и глубиной. Журнал биомеханической инженерии 126: 129–137.
  17. 17. Темпл М.М., Бэ В.К., Чен М.К., Лотц М., Амиэль Д. и др. (2007)Связанное с возрастом и местом биомеханическое ослабление суставного хряща мыщелка бедра человека. Остеоартрит и хрящ / OARS, Общество исследования остеоартрита 15: 1042–1052.
  18. 18. Hsieh C, Lin Y, Lin S, Tsai-Wu J, Herbert Wu CH, et al. (2008) Ультраструктура поверхности и механические свойства хондроцитов человека, выявленные с помощью атомно-силовой микроскопии. Остеоартрит и хрящ / OARS, Общество исследования остеоартрита 16: 480–488.
  19. 19. Barela AMF, Duarte M (2008)Биомеханические характеристики пожилых людей, идущих по суше и воде. Журнал электромиографии и кинезиологии: Официальный журнал Международного общества электрофизиологической кинезиологии 18: 446–454.
  20. 20. Messier SP (1994)Остеоартрит коленного сустава и связанные с ним факторы возраста и ожирения: влияние на походку. Медицина и наука в спорте и упражнениях 26: 1446–1452.
  21. 21. Karamanidis K, Arampatzis A (2009)Доказательства перераспределения механической нагрузки на коленный сустав у пожилых людей при подъеме по лестнице и пандусу.Анналы биомедицинской инженерии 37: 467–476.
  22. 22. Abusara Z, Seerattan R, Leumann A, Thompson R, Herzog W (2010)Новый метод определения механики хондроцитов суставного хряща in vivo. Журнал биомеханики 44: 930–934.
  23. 23. Wilson W, van Donkelaar CC, van Rietbergen R, Huiskes R (2005) Роль вычислительных моделей в поиске механического поведения и механизмов повреждения суставного хряща. Медицинская инженерия и физика 27: 810–826.
  24. 24. Маккерле Дж. (2006) Моделирование и моделирование методом конечных элементов в ортопедии: библиография 1998–2005. Компьютерные методы в биомеханике и биомедицинской инженерии 9: 149–199.
  25. 25. Guilln T, Zhang Q, Tozzi G, Ohrndorf A, Christ H, et al. (2011) Компрессионное поведение бычьей губчатой ​​кости и материалов, аналогичных кости, характеристика микроКТ и анализ FE. Журнал механического поведения биомедицинских материалов 4: 1452–1461.
  26. 26.Кузнецова В.Г., Гирс М.Г., Брекельманс В.А. (2004) Многомасштабная вычислительная гомогенизация второго порядка многофазных материалов: вложенная стратегия конечно-элементного решения. Компьютерные методы в прикладной механике и технике 193: 5525–5550.
  27. 27. Breuls RGM, Sengers BG, Oomens CWJ, Bouten CVC, Baaijens FPT (2002) Прогнозирование локальных деформаций клеток в инженерных тканевых конструкциях: многоуровневый подход конечных элементов. Журнал биомеханической инженерии 124: 198–207.
  28. 28. Эрдемир А., Сиболе С. (2010) Открытое колено: трехмерное конечно-элементное представление коленного сустава, Руководство пользователя, версия 1.0.0:
  29. 29. Маас С., Роулинз Д., Вайс Дж., Атешиан Г. (2010) Руководство по теории FEBio. Университет штата Юта.
  30. 30. Шеперд Д.Э., Сидхом Б.Б. (1999)«Мгновенный» модуль сжатия суставного хряща человека в суставах нижней конечности. Ревматология (Оксфорд, Англия) 38: 124–132.
  31. 31.Батлер Д.Л., Шех М.Ю., Стоуффер Д.К., Самаранаяке В.А., Леви М.С. (1990)Вариации поверхностной деформации сухожилия надколенника человека и крестообразных связок коленного сустава. Журнал биомеханической инженерии 112: 38–45.
  32. 32. Гардинер Дж. К., Вайс Дж. А. (2003) Тематический анализ конечных элементов медиальной коллатеральной связки человека при вальгусной нагрузке на колено. Журнал ортопедических исследований: официальная публикация Общества ортопедических исследований 21: 1098–1106.
  33. 33. Пенья Э., Кальво Б., Мартинес М.А., Добларе М. (2006)Трехмерный анализ конечных элементов комбинированного поведения связок и менисков в коленном суставе здорового человека.Журнал биомеханики 39: 1686–1701.
  34. 34. Фитиан Д.К., Келли М.А., Моу В.К. (1990) Свойства материала и структурно-функциональные отношения в менисках. Клиническая ортопедия и родственные исследования. стр. 19–31.
  35. 35. Тиссахт М., Ахмед А.М. (1995) Характеристики растяжения и деформации материала человеческого мениска. Журнал биомеханики 28: 411–422.
  36. 36. Яо Дж., Сниббе Дж., Малони М., Лернер А.Л. (2006)Напряжения и деформации в медиальном мениске коленного сустава с дефектом передней крестообразной связки при передней нагрузке: анализ конечных элементов с экспериментальной проверкой на основе изображений.Журнал биомеханической инженерии 128: 135–141.
  37. 37. Вайс Дж. А., Мейкер Б. Н., Говинджи С. (1996) Конечно-элементная реализация несжимаемой трансверсально-изотропной гиперупругости. Компьютерные методы в прикладной механике и технике 135: 107–128.
  38. 38. Маас С., Эллис Б.Дж., Роулинз Д.С., Вайс Дж.А. (2009) Сравнение результатов FEBio, ABAQUS и NIKE3D для набора задач проверки. Технический отчет SCI.
  39. 39. Guilak F, Mow VC (2000) Механическая среда хондроцита: двухфазная модель конечных элементов взаимодействия клеток и матрицы в суставном хряще.Журнал биомеханики 33: 1663–1673.
  40. 40. Hunziker EB, Quinn TM, Huselmann H (2002)Количественная структурная организация нормального суставного хряща взрослого человека. Остеоартрит и хрящ / OARS, Общество исследования остеоартрита 10: 564–572.
  41. 41. Михалек А.Дж., Ятридис Дж.К. (2007)Численное исследование для определения модуля перицеллюлярного матрикса и оценки его влияния на микромеханическую среду хондроцитов. Журнал биомеханики 40: 1405–1409.
  42. 42. Гуилак Ф., Алексопулос Л.Г., Хайдер М.А., Тинг-Бил Х.П., Сеттон Л.А. (2005)Зональная однородность механических свойств перицеллюлярного матрикса хондроцитов: аспирация с помощью микропипетки собачьих хондров, выделенных путем гомогенизации хряща. Анналы биомедицинской инженерии 33: 1312–1318.
  43. 43. Alexopoulos LG, Setton LA, Guilak F (2005)Биомеханическая роль перицеллюлярного матрикса хондроцитов в суставном хряще. Acta Biomaterialia 1: 317–325.
  44. 44. Цао Л., Гилак Ф., Сеттон Л.А. (2009)Механика перицеллюлярного матрикса в фиброзном кольце, предсказанная трехмерной моделью конечных элементов и морфологией in situ. Клеточная и молекулярная биоинженерия 2: 306–319.
  45. 45. Peeters EAG, Bouten CVC, Oomens CWJ, Bader DL, Snoeckx LHEH и др. (2004) Анизотропная трехмерная деформация одиночных прикрепленных клеток при сжатии. Анналы биомедицинской инженерии 32: 1443–1452.
  46. 46.Корхонен Р.К., Хан С., Херцог В. (2010)Осмотическая нагрузка хондроцитов in situ в их естественной среде. Молекулярная и клеточная биомеханика: MCB 7: 125–134.
  47. 47. Тетсунага Т., Нисида К., Фурумацу Т., Нарусэ К., Хирохата С. и др. (2011) Регуляция индуцированной механическим стрессом экспрессии MMP-13 и ADAMTS-5 транскрипционным фактором RUNX-2 в хондроцитоподобных клетках SW1353. Остеоартрит и хрящ / OARS, Общество исследования остеоартрита 19: 222–232.
  48. 48.Уорсли П., Стоукс М., Тейлор М. (2011)Прогнозирование кинематики и кинетики коленного сустава во время функциональной деятельности с использованием захвата движения и моделирования опорно-двигательного аппарата у здоровых пожилых людей. Походка и осанка 33: 268–273.
  49. 49. Каземи М., Ли Л.П., Савард П., Бушманн М.Д. (2011)Ползучесть интактных коленных суставов и коленных суставов после менискэктомии. Журнал механического поведения биомедицинских материалов 4: 1351–1358.
  50. 50. Ян Н.Х., Найеб-Хашеми Х., Канаван П.К., Вазири А. (2010)Влияние большеберцово-бедренного угла во фронтальной плоскости на нагрузку и деформацию коленного хряща во время фазы опоры при ходьбе.Журнал ортопедических исследований: официальное издание Общества ортопедических исследований 28: 1539–1547.
  51. 51. Donahue TLH, Hull ML, Rashid MM, Jacobs CR (2002)Конечно-элементная модель коленного сустава человека для изучения большеберцово-бедренного контакта. Журнал биомеханической инженерии 124: 273–280.
  52. 52. Эрдемир А., Сиболе С. (2011)Открытое колено: способность воспроизводить кинематику пассивного сустава. 23-й конгресс Международного общества биомехаников.Брюссель, Бельгия.
  53. 53. Хофер Дж.К., Геджо Р., МакГарри М.Х., Ли Т.К. (2011)Влияние стояния на коленях на тибиофеморальное контактное давление и площадь при тотальном эндопротезировании коленного сустава с сохранением задней крестообразной связки и с жертвой задней крестообразной связки. Журнал эндопротезирования: в печати.
  54. 54. Халлоран Дж. П., Эрдемир А., ван ден Богерт А. Дж. (2009) Адаптивное суррогатное моделирование для эффективного сочетания моделей контроля опорно-двигательного аппарата и деформации тканей. Журнал биомеханической инженерии 131: 011014.
  55. 55. Wang P, Zhu F, Tong Z, Konstantopoulos K (2011)Реакция хондроцитов на напряжение сдвига: антагонистические эффекты партнеров по связыванию, подобных рецептору 4 и кавеолину-1. Журнал FASEB: официальное издание Федерации американских обществ экспериментальной биологии 25: 3401–3415.
  56. 56. Мартинак Б. (2004)Механочувствительные ионные каналы: молекулы механотрансдукции. Журнал клеточной науки 117: 2449–2460.
  57. 57. Sokabe M, Sachs F, Jing ZQ (1991)Количественная видеомикроскопия стресса, напряжения, деформации, емкости и активации канала растяжения мембраны, зажатой патчем.Биофизический журнал 59: 722–728.
  58. 58. Ramage L, Nuki G, Salter DM (2009)Сигнальные каскады в механотрансдукции: взаимодействие клетки с матриксом и механическая нагрузка. Скандинавский журнал медицины и науки в спорте 19: 457–469.

Неферментативное разложение коллагеновых волокон бигликановым антителом и вероятный механизм развития ревматоидного артрита

Abstract

Ревматоидный артрит (РА) представляет собой системное аутоиммунное воспалительное и деструктивное заболевание суставов, которым страдают десятки миллионов людей во всем мире.Нормальные здоровые суставы поддерживают баланс между синтезом молекул внеклеточного матрикса (ECM) и протеолитической деградацией поврежденных суставов. В случае РА этот баланс смещается в сторону разрушения матрикса из-за повышенной продукции ферментов расщепления и присутствия (аутоиммунных) иммуноглобулинов в результате иммунного ответа, вызванного воспалением. Здесь мы демонстрируем, что поликлональное антитело против протеогликана бигликана (BG) вызывает разрушение тканей, которое может быть аналогичным разрушению тканей, пораженных РА.Эффект антител более эффективен, чем агрессивные химические и/или ферментативные препараты, предназначенные для имитации артритоподобной деполимеризации фибрилл. В случаях РА иммунный ответ на воспаление заставляет синовиальные фибробласты, моноциты и макрофаги продуцировать цитокины и секретировать ферменты, ремоделирующие матрикс, тогда как В-клетки стимулируются к продукции иммуноглобулинов. Специфический антиген, вызывающий иммунный ответ при ревматоидном артрите, еще не идентифицирован, хотя были предложены возможные кандидаты, в том числе коллаген типов I и II и протеогликаны (PG), такие как бигликан.Мы предполагаем, что инициирование связанного с РА разрушения тканей in vivo может включать подобное неферментативное разложение коллагеновых фибрилл посредством самих иммуноглобулинов, которое мы наблюдаем здесь ex vivo .

Образец цитирования: Антипова О., Оргель JPRO (2012) Неферментативное разложение коллагеновых волокон бигликановым антителом и вероятный механизм ревматоидного артрита. ПЛОС ОДИН 7(3): е32241. https://doi.org/10.1371/journal.pone.0032241

Редактор: Collin M. Stultz, Массачусетский технологический институт, Соединенные Штаты Америки

Поступила в редакцию: 12 июля 2011 г.; Принято: 25 января 2012 г.; Опубликовано: 13 марта 2012 г.

Copyright: © 2012 Антипова, Оргель. Это статья с открытым доступом, распространяемая в соответствии с лицензией Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания оригинального автора и источника.

Финансирование: Использование усовершенствованного источника фотонов было поддержано Министерством энергетики США, Отделом фундаментальных энергетических наук, Управлением науки по контракту № W-31-109-ENG-38. BioCAT является исследовательским центром RR-08630, поддерживаемым Национальным институтом здравоохранения. Содержание является исключительной ответственностью авторов и не обязательно отражает официальную точку зрения Национального центра исследовательских ресурсов или Национального института здоровья. Эта работа также была поддержана Национальным научным фондом (грант № MCB-0644015 CAREER).Этот материал основан на работе, поддержанной или частично Исследовательской лабораторией армии США и Исследовательским бюро армии США по контракту/гранту номер W911NF 09-1-0378. Спонсоры не участвовали в разработке исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Автор Джозеф Оргел является редактором раздела и членом редакционной коллегии PLoS ONE. Журнал не имел никакого отношения к исследованиям, о которых сообщалось, или к написанию первоначально представленной рукописи.Была подана заявка на патент, относящаяся к данным, представленным в этой рукописи. № 12/419,689: «ТОНКИЙ ВОЛОКОННЫЙ КОЛЛАГЕННЫЙ МАТЕРИАЛ И СПОСОБ ПОЛУЧЕНИЯ ТОНКОГО ВОЛОКОННОГО КОЛЛАГЕНА ИЗ НАТИВНЫХ КОЛЛАГЕННЫХ ВОЛОКН». Это не меняет приверженности авторов всем политикам PLoS ONE в отношении обмена данными и материалами.

Введение

Основными частями сустава, наиболее заметно поражаемыми при РА, являются суставной хрящ и синовиальная оболочка. Коллагеновые фибриллы типа II являются основными структурными элементами хрящевого ВКМ и хрящеподобной хорды хрящевых рыб.Они образуют периодические фибриллы и волокна размером 67 нм с участием протеогликанов (PG), которые связывают коллаген своим сердцевинным белком и регулируют диаметр коллагеновых волокон через свои анионные гликозаминогликановые (AGAG) цепи. Эти взаимодействия коллаген-PG также важны для стабильности волокон/фибрилл и определяют ряд их механических свойств [1]–[5]. В хряще коллаген типа II также агрегирует с другими типами коллагена (I, V, IX и XI) [6] и PG, образуя сложные фибриллярные сети, в отличие от простого расположения в хорде.Хотя сами фибриллы коллагена II типа неразличимы между двумя тканями [7]–[9]. Агрекан в комплексе с гиалуроновой кислотой внедряется в эти сети и аккумулирует значительное количество воды (70% массы хряща) за счет своего сильно отрицательного заряда.

Синовиум, или синовиальная оболочка, представляет собой тонкий слой васкуляризированной мезенхимальной ткани, который окружает полость сустава и вырабатывает синовиальную жидкость, которая отвечает за смазку сустава и питание хондроцитов, поскольку аваскулярный хрящ непроницаем для кислорода и питательных веществ в зрелых суставах [10]. ].ВКМ синовиальной оболочки состоит из коллагеновых фибрилл (типа I, III и V, тип II отсутствует) относительно небольшого диаметра (30 нм) с периодичностью 67 нм и тонких филаментов (10 нм) коллагена типа VI (с 100 нм). нм периодичность), которые интегрированы с гиалуроновой кислотой, фибронектином и фибриллином, обеспечивая тканевую проницаемость и структурную целостность [10].

PG, такие как малые богатые лейцином повторяющиеся белки (sLRRP), декорин и бигликан, необходимы для стабилизации структур пучков фибрилл [11] и для передачи устойчивости к сжатию вместе с гиалуроновой кислотой и аггреканом.Здесь мы сообщаем, что пучки фибрилл коллагена типа II, связанные с бигликаном (или волокна, также известные как толстые фибриллы диаметром 30–50 нм), разлагаются на дискретные фибриллы (также известные как тонкие фибриллы диаметром ~ 10–15 нм) через действие анти-бигликанового антитела даже в отсутствие клеток, ферментов, других антител и в присутствии ингибиторов ферментов. Этот индуцированный антителами процесс приводит к разрушению хорды и появлению тонких фибрилл в образцах хряща.

Результаты и обсуждение

Деградация внеклеточного матрикса при ревматоидном артрите

Частью воспалительной реакции при ревматоидном артрите является высвобождение протеаз, таких как матричные металлопротеиназы (ММР) и «а-дезинтегрин и металлопротеиназы с тромбоспондиновыми мотивами» (ADAMTS), которые расщепляют внеклеточный матрикс синовиальной оболочки и хряща.Основными мишенями в хряще являются коллаген типа II, PG (декорин, бигликан) и аггрекан; их остатки были обнаружены в жидкостях организма больных РА [12]–[15]. В результате протеолиза Полгара поверхностный слой хряща разрушается [16], изменяются его структура и биомеханические свойства. Потеря PG и аггрекана приводит к уменьшению количества молекул воды в хряще и, следовательно, устойчивости к сжатию, но это также может повлиять на стабильность коллагеновых фибрилл и сделать их более уязвимыми для ММП.

Однако начальная деградация ВКМ может происходить в отсутствие протеаз. Сильные механические нагрузки, а также изменения pH могут вызывать фибрилляцию хряща [17], [18]. В суставном хряще больных РА наблюдается обедненное содержание ПГ, сопровождающееся фибриллярной фрагментацией [19]. В то время как повышенные уровни антител к бигликанам были обнаружены в сыворотке и синовиальной жидкости больных РА [20], и они считаются ранними маркерами этого заболевания. Однако точная роль этих антител в инициации и развитии радикальных изменений хряща, вызываемых ревматоидным артритом, остается неясной, равно как и специфический механизм разрушения тканей.Здесь мы представляем доказательства сильного действия антитела к бигликану на хрящевые ткани (хорда миноги) и суставные хрящевые ткани при физиологическом рН и в отсутствие связанных с клеткой или свободных ферментов. В присутствии этого антитела толстые фибриллы коллагена типа II быстро разлагаются на гораздо более мелкие частицы, вызывая необратимое повреждение тканей, что визуализируется с помощью электронной микроскопии, атомно-силовой микроскопии и рентгеновской дифракции (фиг. 1, 2, 3, 4 и 5). Помимо возможного значения этого наблюдения для РА, нам неизвестны какие-либо предыдущие сообщения об аутоиммунных ассоциированных антителах, непосредственно ответственных за индукцию такой деструкции соединительной ткани позвоночных и млекопитающих.

Рис. 1. Разложение фибрилл коллагена II типа в хорде миноги, видимой с помощью ПЭМ (A–D), и в бычьем суставном хряще (E и F).

A) Нативные (до фиксации) коллагеновые фибриллы II типа, инкубированные в TBS в качестве контроля для образцов фибрилл, показанных на B–D. Средний размер фибрилл составляет около 35 нм. B) Коллагеновые фибриллы типа II после непродолжительной инкубации с антибигликановым антителом. Диаметр фибрилл 10–15 нм. C) Волокна коллагена II типа после инкубации в GHCl. Несмотря на серьезные нарушения, разложение фибрилл кажется менее полным, чем при инкубации антител (B).D) Образец коллагена II типа после механического разрушения. Нарушение структуры нативных фибрилл сильно локализовано, при этом большие участки остаются неповрежденными. E) Нативный бычий суставной хрящ (до фиксации и окрашивания для ПЭМ). F) Суставной хрящ крупного рогатого скота после 1-часовой обработки антибигликаном. Черные стрелки указывают на тонкие фибриллы, белые стрелки указывают на толстые фибриллы нормального размера.

https://doi.org/10.1371/journal.pone.0032241.g001

Рисунок 2. Коллагеновые фибриллы типа II, разложенные на их основные агрегаты (вид с помощью рентгеновской дифракции и ПЭМ).

Некоторые части образцов, обработанных антителами, сохраняют свободное выравнивание тонких фибрилл, что позволяет анализировать их с помощью малоугловой рентгеновской дифракции (A) и вставки B. Очевидна функция упаковки 11 и 4,5 нм, которая появляется чтобы соответствовать приблизительному диаметру тонких фибрилл (вставка C) и микрофибрилл (D). Нативные толстые фибриллы показаны на C в сравнении с продуктом разложения (тонкие фибриллы).

https://doi.org/10.1371/журнал.pone.0032241.g002

Рис. 3. Модель действия антител на фибриллы коллагена II типа.

Координатные модели комплекса коллагеновых фибрилл бигликанового типа II, основанные на структурах коллагеновых фибрилл декоронного типа I, опубликованных недавно (1), показаны с модельной единицей Fab (зеленый), присоединенной к бигликановому (синему) эпитопу (окрашенному красным, А и вид «сверху» Б). Поскольку эпитоп расположен в заполненном растворителем канале коллагеновой фибриллы [33], есть место для стыковки петель fab с ним, но он расположен близко к сети водородных связей фибрилла-PG, расположенной между поверхностью коллагеновых фибрилл и вогнутая сторона структуры PG-ядерных белков (1) может нарушить положительные взаимодействия и вытеснить сердцевинный белок из фибриллы.Приводит к разделению толстых фибрилл на составляющие их тонкие фибриллы (С).

https://doi.org/10.1371/journal.pone.0032241.g003

Рисунок 4. TEM-изображения препаратов суставного хряща человека.

A) Срез нативного суставного хряща человека, инкубированный в TBS, который имеет фибриллы коллагена II типа обычного диаметра 30–50 нм (контроль для образцов B–D). B) Срез суставного хряща человека, обработанный ABC-лиазой в течение 24 часов, с некоторыми тонкими фибриллами коллагена II типа.C) Срез суставного хряща человека, обработанный гидрохлоридом гуанидина в течение 24 часов, с наличием тонких 10–15 нм фибрилл и нормальных толстых фибрилл (пучки фибрилл). D) Срез суставного хряща человека, обработанный антибигликановым антителом в течение 24 часов, показывает некоторые тонкие фибриллы коллагена II типа, а также фибриллы обычного диаметра 30–50 нм. Стрелки указывают на разлагающиеся фибриллы.

https://doi.org/10.1371/journal.pone.0032241.g004

Рисунок 5. АСМ и ПЭМ изображения нативных и обработанных Ab образцов сухожилия хвоста крысы и хорды миноги.

A) Контрольные данные АСМ коллагеновых фибрилл I типа: нативные фибриллы I типа. B) Контрольные данные АСМ коллагеновых фибрилл типа I: антитело против сердцевинного белка PG, конъюгированное с частицами размером 30 нм, прикрепленными к фибриллам типа I. Обратите внимание, что фибриллы не повреждены, а частицы золота четко различимы в виде плотно упакованных глобул. C) АСМ-изображение нативных фибрилл миноги II типа. D) АСМ-изображение фибрилл миноги II типа после обработки антибигликановыми антителами, конъюгированными с золотыми частицами, как на B.Сравните с B. Частицы золота не видны, в то время как в контроле с коллагеном I типа они видны четко. E) Неокрашенная ПЭМ коллагеновых фибрилл, полученных из миноги, после обработки антибигликанами. Антитела в этом препарате были конъюгированы с частицами золота размером 10 нм и все еще были способны разлагать толстые фибриллы на тонкие фибриллы, но после промывки препарата в TBS частицы золота не видны. F) Неокрашенная ТЭМ агрегатов бигликанов, прикрепленных к антителам, конъюгированным с золотыми частицами.Частицы золота отчетливо видны в виде плотных черных пятен, не проявляющихся у E.

.

https://doi.org/10.1371/journal.pone.0032241.g005

Разложение тканей, индуцированное антителами

Нативные фибриллы хорды миноги не обнаруживают каких-либо заметных различий между ее коллагеновыми волокнами типа II и волокнами, наблюдаемыми в тканях млекопитающих [21] (РИС. 1). Они имеют одинаковый диаметр около 35 нм и типичную положительную картину окрашивания, хотя есть некоторые различия в содержании клеток и протеогликанов, а также архитектуре тканей.Хорда миноги, по-видимому, имеет очень специфическое распределение клеток (слоистое, за пределами полос внеклеточного материала), тогда как хрящевые клетки встроены в коллагеновую сеть и могут быть видны по всей ткани. Содержание PG хорды миноги довольно простое и содержит только бигликаны типа I и II (которые очень близки по последовательности к бигликанам быка или человека и, следовательно, структурно связаны с декорином и фибромодулином), в отличие от хряща млекопитающих, который имеет несколько типов. присутствующих PG и гликопротеинов [22], [23].

ПЭМ-изображения тканей миноги, обработанных бигликановыми антителами, показали (рис. 1–2) разительное отличие от нативных волокон: было заметное отсутствие нативных толстых фибрилл (таблицы S1 и S2) и 2) ВКМ стал значительно менее упорядоченным. Хорда, обработанная антителами (фиг. 1В), после обработки была очень хрупкой и легко деформировалась, не выдерживая даже минимального напряжения (<5%) без ее разрушения.Ткани млекопитающих не были затронуты столь резко (фиг. 1 и 4), но в них также наблюдалось появление тонких фибрилл и разорванных волокон в присутствии антитела, отсутствующих в контрольных (предварительно обработанных) срезах в таких количествах (фиг. 1). Разница в относительном воздействии на две ткани животных (хрящ против хорды) предположительно связана с тем, что хрящ млекопитающих обладает более широким репертуаром sLRRP, которые либо полностью, либо частично устойчивы к действию антибигликанового антитела (см. ниже). .Таким образом, хорда миноги, содержащая только бигликан, более восприимчива к любым предполагаемым эффектам ее антител. Независимо от разницы в масштабе эффекта, между тканями было сделано одно и то же неожиданное наблюдение: значительное и быстрое неферментативное расщепление коллагеновых фибрилл происходит в присутствии антибигликанового антитела. Крупные структуры белка ядра BG, наблюдаемые в ПЭМ инкубационного раствора с присутствием частиц золота. Биохимический анализ показывает значительно повышенные уровни BG в этом растворе по сравнению с контролями, не содержащими ab (см. методы SI S1, таблицы S3 и S4 и ФИГ.5).

Мы предполагаем, что антибигликановые антитела прикрепляются к бигликановым коровым белкам на поверхности толстых фибрилл и что это взаимодействие нарушает связь между коровым белком и молекулами коллагена, составляющими фибриллы. Несмотря на то, что мостики ГАГ остаются интактными, ослабление взаимодействия бигликан-кор-белок-коллаген «развязывает нить», которая удерживает толстые фибриллы вместе (РИС. 3). Это также означает, что «толстые волокна» на самом деле представляют собой пучки тонких волокон (т.е. «пучки фибрилл», обсуждаемые на протяжении всего исследования). Принимая во внимание, что «тонкая фибрилла» [24] представляет собой нередуцируемую коллагеновую фибриллу (без ферментативного расщепления или механической силы), сформированную из плотно упакованных молекул коллагена и удерживаемых вместе посредством взаимодействия коллаген-коллаген, таких как лизин-гидроксилизиновые связи.

Органы управления

Чтобы проверить гипотезу о том, что разрушение взаимодействия бигликанового корового белка и коллагена является причиной расщепления фибрилл, образцы хорды миноги обрабатывали гидрохлоридом гуанидина и ABC-лиазой соответственно в качестве положительного контроля.Гидрохлорид гуанидина вызывает денатурацию белка, поэтому его действие будет имитировать предполагаемое действие бигликанового антитела, хотя и более резким и менее специфичным. ПЭМ-изображения хорды и хряща, обработанных гуанидином, продемонстрировали тот же тип деградации коллагеновых фибрилл, хотя время инкубации должно было быть намного больше (24 часа вместо 1 часа для антитела) для достижения аналогичной степени разложения. Напротив, ABC-лиаза удаляет цепь AGAG из ядра белка и должна давать аналогичные результаты, хотя и с помощью другого структурного механизма.Тонкие фибриллы в образцах хорды и суставного хряща были видны на ПЭМ-изображениях после этой обработки, хотя повреждение было относительно легким по сравнению с разложением, опосредованным антителами. В дополнение к этим химическим методам деградации тканей исследовалась также механическая деградация. К нативным тканям хорды миноги применяли трение, и результаты этого повреждения анализировали с помощью ПЭМ и сравнивали с другими экспериментами. Механическое воздействие, использованное в данном исследовании, может соответствовать повреждению суставного хряща в результате травмы или естественного износа.Наблюдалось присутствие тонких фибрилл (отсутствие регулярных фибрилл 30–50 нм) в определенных областях, которые подвергались более высокой нагрузке, хотя некоторые участки ткани все еще имели нормальную архитектуру по сравнению с неповрежденными, необработанными контрольными образцами. Наконец, значительная деградация ткани (и высвобождение бигликанов) наблюдалась в присутствии ингибиторов протеазы, но не в присутствии альтернативных антител, таких как антитела против коллагена (см. методы SI S1).

Структура хорды: различия в масштабе действия антибигликанов на миногу и миногу.ткани млекопитающих

Хорда миноги представляет собой хрящевидную ткань, протянувшуюся по всей длине спины хордовых, расположенную ниже и параллельно центральной нервной системе между мозгом и хвостом. Хотя хорда является основным осевым скелетом на эмбриональной стадии, у большинства позвоночных хорда заменяется позвоночным столбом. Однако у некоторых хордовых он остается во взрослом возрасте (например, у миноги, двоякодышащих рыб, осетровых и некоторых акул). Зрелая хорда содержит мягкую клеточную внутреннюю часть, окруженную защитной фиброзной оболочкой, состоящей из трех слоев: внутренней базальной пластинки, толстого коллагенового (хрящеподобного) слоя и эластичной филаментозной мембраны [25].Состав коллагеновой части хорды миноги довольно прост по сравнению с суставным хрящом, что делает ее очень удобной для изучения. Он имеет две основные ориентации волокон коллагена II типа: кольцевую (перпендикулярную основной оси тела) и продольную (параллельную основной оси тела). Продольно организованные волокна расположены во внешнем слое и являются наиболее распространенными. Фибриллярная архитектура поддерживается бигликанами миноги. Хотя организация суставного хряща и хорды миноги, по-видимому, различна, структура фибрилл коллагена II типа в обоих из них неразличима [25], а их последовательность в высокой степени гомологична.

Вариации разного уровня повреждения (тонкие/нормальные фибриллы коллагена II типа), очевидные на ПЭМ-изображениях тканей млекопитающих и миноги, можно объяснить различиями в молекулярном составе этих тканей, что, в свою очередь, влияет на архитектуру ткани. Хорда миноги содержит в основном коллаген типа II и бигликан. Суставной хрящ человека и быка содержит бигликан, фибромодулин, декорин и другие молекулы ВКМ, которые регулируют фибриллогенез, диаметр волокон, поддерживают волокна и придают ткани специфические механические свойства.Хрящ и мениск содержат больше бигликана, чем декорина, и соотношение меняется от зоны к зоне. Поверхностная зона содержит около 32 % декорина и 38 % бигликанов от всего содержания ПГ, внутренняя глубокая зона содержит около 23 % декорина и 53 % бигликанов от всех ПГ, а средняя зона — 28 % декорина и 52 % бигликан всех ПГ [26]. В результате можно ожидать, что эти ткани будут более устойчивы к кратковременному (1-2 часа) лечению антителами. Из-за присутствия декорина, который кажется стабильным в присутствии антитела (это антитело имеет более высокое сродство к бигликану, чем декорин).Но более длительное воздействие бигликановых антител на ткани хряща оказывает более сильное влияние на диссоциацию коллагеновых волокон хряща, по-видимому, потому, что антителам требуется больше времени для проникновения в более глубокие слои, где преобладает бигликан.

Концентрация антител и эффект

Несмотря на то, что наши наблюдения относятся к ex vivo , стоит отметить, что уровни концентрации антител к аутоиммунным заболеваниям человека были зарегистрированы в жидкостях организма на уровне, аналогичном или выше, чем мы применяли в наших экспериментах [27]–[29], хотя мы также наблюдали этот эффект при более низких исходных концентрациях (см. методы SI S1).Более того, наблюдаемое разложение фибрилл проникало в образцы целых тканей, погруженных во флаконы, содержащие антитела. Концентрация антитела во внутренней части ткани должна быть значительно ниже, чем в окружающем растворе, и тем не менее она вызывает деградацию ткани. То, что эффект наблюдался за столь короткий промежуток времени (в хорде), также имеет значение.

Учитывая, что концентрация используемого антитела может быть физиологически значимой, природа его разрушающего действия может быть такой же in vivo , как и в наших экспериментах ex vivo , будь то за счет конкурентного разрыва связи или стерического отталкивания, или того и другого.Однако, как показано на фиг. 3 показывает, что маловероятно, что более одной молекулы антитела могут локализоваться в одном эпитопе корового белка бигликана, что делает рассмотрение стерического отталкивания менее вероятным. Особенно в свете опубликованных исследований, которые показывают, что конформации sLRRP нелегко поддаются значительным изменениям в их дугообразной структуре, но, по-видимому, чувствительны к влиянию окружающей среды на их внутреннее ядро ​​​​к сети водородных связей коллагеновых фибрилл [1], [4]. Тот факт, что мы наблюдали некоторую чувствительность тканей к определенным солям в буферных системах (см. методы SI S1 и PBS) и что простые условия денатурации (см. результаты GHCL с гуанидин гидрохлоридом) были менее эффективны, чем применение антитела, можно считать дополнительным доказательством в пользу интерференционного эффекта антибигликанового антитела.Давно известно, что рН вызывает диссоциацию пучков коллагеновых волокон на более мелкие частицы [30], [31], последнее упоминание предполагает, что протеогликаны sLRRP чувствительны как к соли, так и к рН. Тот факт, что мы наблюдали этот эффект при естественном рН в буферной системе на основе фосфата, по-видимому, соответствует этим предыдущим соображениям. То, что мы не наблюдали деградации пучков фибрилл в контрольной группе TBS и более плохое разрушение пучков фибрилл в TBS с помощью GHCL или ферментативного катализа, предполагает новый эффект антибигликанового антитела против пучков волокон коллагена II типа.То, что тонкие фибриллы не подвергались дальнейшей деградации, а оставались неопределенно стабильными, исключает возможность наличия общей или специфичной для коллагена протеиназы. Значительно повышенные уровни бигликана, обнаруженные в растворе анти-бигликана, в котором ткань инкубировали по сравнению с контролями без анти-антитела, подтверждают гипотезу о том, что анти-бигликан вызывает диссоциацию бигликана от толстых фибрилл.

Сайт расщепления ММП коллагеновой фибриллы и домен взаимодействия с коллагеназой

Коллагеновые фибриллы собраны таким образом, что сайт расщепления ММП коллагеназой защищен С-телопептидом в свернутой конформации [32]–[34].Этот свернутый С-телопептид соответствует хребту X3 в коллагене типа I и, по-видимому, имеет аналогичную структуру в коллагене типа II, как видно из данных АСМ и рентгеновской дифракции [32], [33]. С-телопептид обычно ковалентно связан с соседними молекулами коллагена, что делает его конформацию очень стабильной. Чтобы получить доступ к сайту расщепления ММР, другие протеазы должны сначала расщепить С-телопептид. Этот процесс очень медленный с одной только MMP1 из-за очень небольшого числа доступных мест расщепления (предположительно на кончиках фибрилл, где упаковка коллагена более рыхлая).Наши результаты показывают, что бигликановое антитело может индуцировать процесс распада коллагеновых волокон в хрящеподобных тканях. Даже короткое одночасовое воздействие на хорду миноги бигликанового антитела полностью изменило структуру коллагенового матрикса. На самом деле в обработанной хорде было лишь несколько областей, которые не претерпели существенных изменений (фибриллы разъединились, но остались близкими и параллельными друг другу) и, следовательно, были способны давать дифракционные картины (РИС. 2). Даже в этих «менее пораженных» участках ткани наблюдались значительные структурные изменения и, что наиболее важно, практически равномерный фибриллярный распад.Наши предварительные данные (не показаны) ферментативного расщепления инкубированной антителом хорды показали, что ткань разлагалась как минимум в 2 раза быстрее, чем контрольная (при 4°С по сравнению с ММР1, трипсином и пепсином), что указывает на то, что ранее экспонированные сайты расщепления обнажались из-за действия антитела на BG (т.е. из-за того, что пучки фибрилл разрушались, давая составляющие их тонкие фибриллы и бигликан, см. фиг. 3 и 5).

Предположительный молекулярный механизм разрушения тканей при ревматоидном артрите

Наблюдаемая деструкция ткани в хорде миноги и аналогичное разрушение фибрилл в суставном хряще в ответ на лечение антибигликанами могут иметь значение для здоровья и старения человека.Повышенные уровни антибигликановых антител обнаруживаются в жидкостях организма больных артритом [20] и считаются ранними маркерами этого заболевания, но их конкретная роль ранее не выяснена. Наличие более тонких волокон и высокая концентрация продуктов расщепления коллагена также связаны с явлениями РА [35]. Наши результаты лечения бигликановыми антителами — взаимодействия коллагена хряща и хорды, визуализированные с помощью ПЭМ и подтвержденные данными рентгеновской дифракции, основанными на строении коллагеновых фибрилл и коллагенолизе [32], [33], [36], [37], могут быть использованы для предположения механизм деградации коллагенового матрикса ММП, инициированный аутоиммунитетом.Известно, что взаимодействие коллагеновых и хрящевых ПГ сильно зависит от их специфической конформации [38]. Таким образом, даже небольших изменений может быть достаточно, чтобы нарушить связь между молекулами бигликана и коллагена. Недавняя работа по определению природы взаимодействия между гомологом бигликана, декорином, и фибриллой коллагена типа I предполагает, как это может происходить; нарушение сети водородных связей интерфейса PG-коровый белок-коллагеновые фибриллы [4] в области антибигликанового эпитопа антитела (см. методы).Поэтому мы предполагаем, что процесс разрушения тканей РА мог начаться здесь или быть одним из ранних факторов, ведущих к патологическому каскаду РА:

  1. Антитела против бигликана (и, возможно, других сердцевинных белков sLRRP, хотя бигликан, по-видимому, является наиболее уязвимым, поскольку декорин не подвергается воздействию, несмотря на его близкую гомологию) связывается с коровым белком PG и разрушает сеть водородных связей внутри вогнутой части поверхность, которая связывается с фибриллой коллагена.
  2. Бигликановый коровый белок отделяется от коллагеновых фибрилл, и пучок фибрилл распадается на тонкие фибриллы.
  3. После диссоциации от пучка фибрилл тонкие фибриллы коллагена II типа имеют большее количество каталитических участков (увеличенное отношение площади поверхности к объему) и становятся уязвимыми для связывания, раскручивания и расщепления коллагеназой и желатиназой (см. выше и ссылки). 33], [37]). Следовательно, этот измененный коллагеновый матрикс более хрупок и легко переваривается протеазами.
  4. Мы также предполагаем, что с разрушением этих молекулярных агрегатов множество обычно скрытых эпитопов или эпитопов с низкой концентрацией, таких как продукты распада PG, пептиды коллагена и т. д., станут присутствовать в более высоких концентрациях, чем раньше. Теоретически это может инициировать иммунологический каскад, ведущий к дальнейшей аутоиммунной активности тканей и ухудшению течения заболевания.

Хорда миноги имеет довольно простой состав по сравнению с хрящом млекопитающих, но это делает ее привлекательной и подходящей моделью систем млекопитающих для начального исследования нормальных и патологических процессов в хряще на фибриллярном уровне.Изученное взаимодействие антибигликановых антител с ВКМ хорды может служить моделью механизма ревматоидного артрита и потенциально может использоваться в качестве упрощенной модельной системы РА. Визуализация тканей, обработанных антителами, в различных условиях вдохновляет на спекулятивную модель разрушения тканей, аналогичную модели, наблюдаемой при аутоиммунно-индуцированном ревматоидном артрите, характеризующемся разложением коллагенового матрикса из-за разрушения PG антителами против бигликанов. Эта предложенная модель подчеркивает решающую роль бигликанового антитела в развитии ревматоидного артрита, и наши связанные наблюдения дают первое указание на то, какова его роль, помимо того, что он является маркером этого распространенного и широко распространенного заболевания.

Материалы и методы

Материалы

взрослых морских миног были подарены Лудингтонской биологической станцией Службы охраны рыбных ресурсов и дикой природы США и Дж. Эллен Марсден из Университета Вермонта. Суставной хрящ человека и быка, хранящийся в физиологических условиях, был предоставлен Университетом Тома Шмита и Винсента Ван Раша. Все образцы были получены в рамках соответствующих институциональных научных наблюдательных советов от местных учреждений, сдающих ткани.

Первичная подготовка ткани

Хорда

миноги была извлечена и приготовлена ​​из препарированной миноги, как описано ранее. Суставной хрящ крупного рогатого скота соскоблили с суставной поверхности. Пробки суставного хряща человека собирали из донорских тканей. Все ткани хранили в ТБС* при 4°С и рН = 7–7,5.

Обработка антителами для ПЭМ и рентгеновской дифракции

Поликлональные бигликановые антитела (Novus, эпитоп: DRLAIQFGNYKK) с концентрацией 0,5 мг/мл хранились в 0.Флаконы по 5 мл при 4°C. Тонкие кусочки хряща/хорды инкубировали в растворе антител в течение 1, 2 и 24 часов. Образцы промывали в ТБС 2 раза по 5 мин и хранили в ТБС рН = 7,0 при 4°С. Специфичность антитела ранее была подтверждена Chen et al. [39]. Раствор, в котором ткань инкубировали в присутствии антитела, собирали для анализа (см. методы SI S1). Изображения AFM и TEM были записаны для интактных, не обработанных антителами фибрилл типа II из хорды миноги и суставного хряща крупного рогатого скота, разложившихся фибрилл типа II из обеих тканей и инкубирующего раствора.Кроме того, данные микроскопии собирали из коллагеновых фибрилл типа I, выделенных из сухожилия хвоста крысы с антителом, конъюгированным с золотом (и нативными необработанными фибриллами), в качестве контрольных данных.

Методы продолжаются в Методах SI S1.

Вспомогательная информация

Таблица S1.

Количество видов фибрилл/волокон на квадратный микрон: Количество фибрилл/волокон каждого типа: тонкие фибриллы, толстые волокна/фибриллы; для каждой ткани: хорда миноги, хрящ быка и хрящ человека; в каждом состоянии: нативное (контрольное) и обработанное ab.Подсчеты усреднены на 1 квадратный микрон площади.

https://doi.org/10.1371/journal.pone.0032241.s001

(DOC)

Таблица S2.

Размер видов фибрилл/волокон: Средний диаметр фибрилл/волокон каждого класса для каждого типа ткани (см. методы), измеренный в нм. Обратите внимание, что наличие больших пучков фибрилл завышает определенный средний размер «толстых фибрилл».

https://doi.org/10.1371/journal.pone.0032241.s002

(DOC)

Благодарности

Мы благодарим Лудингтонскую биологическую станцию ​​США.С. Службы рыболовства и дикой природы и Дж. Эллен Марсден из Университета Вермонта за пожертвование образцов миноги, а также доктор Винсент Ван и доктор Том Шмидт из Университета Раш за пожертвование образцов хряща. Выражаем благодарность Yimei Chen из Центра электронной микроскопии Чикагского университета за помощь в подготовке образцов и сборе данных ПЭМ, а также Джареду Лапковскому за помощь с изображениями TEM, полученными на низковольтном (5 кВ) настольном TEM LVEM5 компанией Delong America, Монреаль. , Канада. Наша благодарность коллегам из IIT за их помощь в маркировке золота и сборе данных АСМ; Сандра Бишной и Аруна Сундарам.Особая благодарность сотрудникам и ученым группы BioCAT.

Авторские взносы

Задумал и спроектировал эксперименты: OA JO. Выполняли опыты: OA JO. Проанализированы данные: OA JO. Предоставленные реагенты/материалы/инструменты для анализа: OA JO. Написал статью: OA JO.

Каталожные номера

  1. 1. Scott JE (1996) Протеодерматановые и протеокератансульфатные (декорин, люмикан/фибромодулин) белки имеют подковообразную форму. Последствия их взаимодействия с коллагеном.Биохимия 35: 8795–8799.
  2. 2. Амей Л., Ария Д., Джепсен К., Олдберг А., Сюй Т. и др. (2002) Аномальные коллагеновые фибриллы в сухожилиях мышей с дефицитом бигликанов/фибромодулина приводят к нарушению походки, эктопической оссификации и остеоартриту. Журнал FASEB 16: 673–680.
  3. 3. Робинсон П.С., Хуанг Т.Ф., Казам Э., Иоццо Р.В., Бирк Д.Е. и др. (2005) Влияние декорина и бигликана на механические свойства множественных сухожилий нокаутных мышей. J Biomech Eng 127: 181–185.
  4. 4. Orgel JPRO, Eid A, Antipova O, Bella J, Scott JE (2009) Форма основного белка декорина (Decoron) дополняет структуру поверхности коллагеновых фибрилл и опосредует их связывание. ПЛОС ОДИН 4: e7028.
  5. 5. Фурукава Т., Ито К., Нука С., Хашимото Дж., Такей Х. и др. (2009)Отсутствие бигликана ускоряет дегенеративный процесс в межпозвонковом диске мыши. Позвоночник 34: E911–E917.
  6. 6. Marchant J, Hahn R, Linsenmayer T, Birk D (1996) Снижение коллагена типа V с использованием доминантно-негативной стратегии изменяет регуляцию фибриллогенеза и приводит к потере морфологии фибрилл, специфичной для роговицы.J Cell Biol 135: 1415–1426.
  7. 7. Келли Дж., Танака С., Хардт Т., Эйкенберри Э.Ф., Бродский Б. (1988) Коллагены, образующие фибриллы, у миноги. J Biol Chem 263: 980–987.
  8. 8. Эйкенберри Э.Ф., Чайлдс Б., Шерен С.Б., Парри Д.А., Крейг А.С. и др. (1984) Структура кристаллических фибрилл коллагена II типа в оболочке хорды миноги. Дж. Мол. Биол. 176: 261–277.
  9. 9. Бродский Б., Белбруно К.С., Хардт Т.А., Эйкенберри Э.Ф. (1994)Структура коллагеновых фибрилл у миноги.Дж. Мол. Биол. 243: 38–47.
  10. 10. Comper WD (1996) Внеклеточный матрикс. КПР Пресс. 464 стр.
  11. 11. Iozzo RV (2000) Протеогликаны. КПР Пресс.
  12. 12. Ландеве Р., Гезенс П., ван дер Хейде Д., Бурс М., ван дер Линден С. и др. (2006)Артрит мгновенно вызывает деградацию коллагена типа I и типа II у пациентов с ранним ревматоидным артритом: продольный анализ. Анналы ревматических заболеваний 65: 40–44.
  13. 13.Krajickova J, Macek J (1988)Выделение продуктов распада протеогликанов с мочой у пациентов с ревматоидным артритом и остеоартритом. Анналы ревматических болезней 47: 468–471.
  14. 14. Мелроуз Дж., Фуллер Э., Роули П., Смит М., Керр Б. и др. (2008) Фрагментация декорина, бигликана, люмикана и кератокана повышена в дегенеративных человеческих менисках, коленных и тазобедренных суставных хрящах по сравнению с макроскопически нормальными и контрольными тканями того же возраста. Исследования и терапия артрита 10: R79.
  15. 15. Ларк М., Бейн Э., Фланаган Дж., Харпер С., Хёррнер Л. и др. (1997) Деградация аггрекана в хрящах человека. Доказательства активности как матриксной металлопротеиназы, так и агреканазы в нормальных, остеоартритных и ревматоидных суставах. Журнал клинических исследований 100: 93–106.
  16. 16. Отеро М., Голдринг М. (2007)Клетки синовиальной оболочки при ревматоидном артрите. Хондроциты. Arthritis Research & Therapy 9: 220.
  17. 17. Кларк Дж. М., Симонян П. Т. (1997) Сканирующая электронная микроскопия «фибриллированного» и «яблочного» суставного хряща человека: технические соображения.Microsc Res Tech 37: 299–313.
  18. 18. Price J, Wang-Weigand S, Bohne R, Kozaci L, Hollander A (1999) Вызванная ретиноевой кислотой деградация коллагена типа II не коррелирует с активностью матриксной металлопротеиназы в культурах эксплантатов хряща. Артрит и ревматизм 42: 137–147.
  19. 19. Митчелл Н.С., Шепард Н. (1978)Изменения протеогликанов и коллагена в хрящах при ревматоидном артрите. J Bone Joint Surg Am 60: 342–348.
  20. 20. Полгар А., Фалус А., Ку Э., Уйфалусси И., Сештак М. и др.(2003) Повышенные уровни антител синовиальной жидкости, реагирующих с небольшими протеогликанами бигликаном и декорином, у пациентов с ревматоидным артритом или другими заболеваниями суставов. Ревматология 42: 522–527.
  21. 21. Шерен С.Б., Эйкенберри Э.Ф., Брук Д.Л., ван дер Рест М., Деринг Т. и соавт. (1986)Коллаген II типа миноги. Comp Biochem Physiol B 85: 5–14.
  22. 22. Buckwalter JA, Rosenberg LC (1988)Электронно-микроскопические исследования протеогликанов хряща. Электрон Микроск Ред. 1: 87–112.
  23. 23. Синтани С., Сато А., Тойосава С., О’хУигин С., Кляйн Дж. (2000) Бигликаноподобные гены внеклеточного матрикса бесчелюстных и костистых. Дж. Мол Эвол 51: 363–373.
  24. 24. Холмс Д., Кадлер К. (2006)Структура микрофибрилл 10 + 4 тонких хрящевых фибрилл. Proc Natl Acad Sci U S A 103: 17249–17254.
  25. 25. Pasteels J (1958) Развитие беспозвоночных. В: Грассе П., редактор. Traité de Zoologie. Париж: Masson et Cie. С. 106–144.
  26. 26.Скотт П., Накано Т., Додд С. (1997) Выделение и характеристика малых протеогликанов из различных зон мениска коленного сустава свиньи. Biochimica et biophysica acta-general subject 1336: 254–262.
  27. 27. Kresina TF, Finegan CK (1986)Ограниченная экспрессия изотипов антител против коллагена II типа у мышей, подавленных коллаген-индуцированным артритом. Энн Реум Дис 45: 60–66.
  28. 28. Toda G, Ikeda Y, Hashimoto N, Maruyama T, Oka H (1987)Диагностический маркер аутоиммунного хронического активного гепатита: антитела к плазматической мембране печени в сыворотке, абсорбированной частицами гомогената почек.Гастроэнтерол Jpn 22: 303–311.
  29. 29. Gyorgy B, Tothfalusi L, Nagy G, Pasztoi M, Geher P, et al. (2008)Естественные аутоантитела, реагирующие с гликозаминогликанами при ревматоидном артрите. Исследования и терапия артрита 10: R110.
  30. 30. Cox RW, Grant RA, Kent CM (1973)Электронно-микроскопическое исследование реакции коллагена с некоторыми моноальдегидами и бифункциональными альдегидами. J Cell Sci 12: 933–949.
  31. 31. Скотт Дж. Э. (1991) Протеогликан: взаимодействие коллагена в соединительных тканях.Ультраструктурные, биохимические, функциональные и эволюционные аспекты. Международный журнал биологических макромолекул 13: 157–161.
  32. 32. Антипова О., Orgel JPRO (2010) In situ D-периодическая молекулярная структура типа II. Журнал биологической химии 285: 7087–7096.
  33. 33. Perumal S, Antipova O, Orgel JP (2008)Архитектура фибрилл коллагена, организация домена и конформация тройной спирали управляют его протеолизом. Proc Natl Acad Sci USA 105: 2824–2829.
  34. 34. Claffey W (1977) Интерпретация малоугловой рентгеновской дифракции коллагена с учетом первичной структуры цепи альфа1. Биофизический журнал 19: 63–70.
  35. 35. Митчелл Н.С., Шепард Н. (1978)Изменения протеогликанов и коллагена в хрящах при ревматоидном артрите. J Bone Joint Surg Am 60: 342–348.
  36. 36. Orgel JP, Irving TC, Miller A, Wess TJ (2006)Микрофибриллярная структура коллагена I типа in situ. Proc Natl Acad Sci U S A 103: 9001–9005.
  37. 37. Orgel JPRO, San Antonio JD, Antipova O (2011)Молекулярное и структурное картирование взаимодействий коллагеновых фибрилл. Исследования соединительной ткани 52: 2–17.
  38. 38. Vynios DH, Papageorgakopoulou N, Sazakli H, Tsiganos CP (2001)Взаимодействия протеогликанов хряща с коллагеном определяются их структурой. Биохимия 83: 899–906.
  39. 39. Chen W-B, Lenschow W, Tiede K, Fischer JW, Kalthoff H, et al. (2002)Smad4/DPC4-зависимая регуляция экспрессии гена бигликана путем трансформации фактора роста-бета в опухолевых клетках поджелудочной железы.J Biol Chem 277: 36118–36128.

Микроокружение в субхондральной кости: преобладающий регулятор для лечения остеоартрита

Нормальная архитектура субхондральной кости

Субхондральная кость делится на две анатомические единицы: субхондральную костную пластинку и субхондральные трабекулы. Субхондральная костная пластинка представляет собой тонкую кортикальную пластинку, расположенную под обызвествленным хрящом. Это проницаемая структура с взаимосвязанной пористостью. Через поры проходят многочисленные сосуды и нервы, отдающие ветви в обызвествленный хрящ.12 Субхондральные трабекулы, расположенные ниже субхондральной костной пластинки, представляют собой пористые структуры с многочисленными сосудами и нервами, которые играют важную роль в поглощении нагрузки и структурной поддержке, а также в снабжении хряща питательными веществами. сустав динамически через скоординированное ремоделирование кости.14 Ремоделирование кости включает сочетание остеокластической резорбции кости и образования остеобластной кости для замены поврежденной кости новой костью.15 Однако субхондральная кость и хрящ демонстрируют различные способности к механической адаптации. Хотя хрящ модулирует функциональное состояние в ответ на механическое повреждение, его способность восстанавливать и модифицировать окружающий внеклеточный матрикс более ограничена, чем у субхондральной кости.16 Субхондральная кость быстро реагирует на механическую нагрузку путем ремоделирования кости, а затем восстанавливает нормальные физиологические условия. .17

Микроструктурные и гистопатологические изменения субхондральной кости при ОА

Возникновение дегенерации хряща и деструкции субхондральной кости всегда было спорным вопросом.18 Не у всех пациентов с ОА наблюдается прогрессирование аномального костеобразования в субхондральной кости. Более того, у части пациентов с ОА наиболее ранние изменения обнаруживаются в участках субхондральной кости. ОА обычно считают дегенеративным заболеванием, связанным со старением и травмой. При ОА, вызванном старением, можно подтвердить, что аберрантный метаболизм хондроцитов играет решающую роль в возникновении повреждения хряща до аномального образования субхондральной кости.19 И наоборот, ранние микроповреждения в участках субхондральной кости обнаруживаются при ОА, вызванном травмой.20 Примечательно, что изменения субхондральной кости не совсем одинаковы в разных суставах при ОА. Имеются убедительные доказательства того, что патологические изменения в различных суставах (таких как коленный, позвоночник и височно-нижнечелюстной сустав) проявляются несколькими видами признаков.21-25

На разных стадиях ОА отмечаются отчетливые микроструктурные изменения в субхондральной кости. На ранних стадиях ОА наблюдается усиленный метаболизм субхондральной кости. Кроме того, в запущенной и поздней стадиях наблюдается склероз субхондральной кости.26–28 При раннем ОА субхондральная костная пластинка становится тоньше и более пористой во время начальной дегенерации хряща. Субхондральные трабекулы изнашиваются с увеличением трабекулярного разделения и уменьшением толщины трабекул.29 Наоборот, субхондральная костная пластинка и трабекулы становятся толще, что сопровождается склерозом субхондральной кости и уменьшением расстояния между костным мозгом на поздних стадиях ОА. В то же время некальцифицированный хрящ демонстрирует прогрессирующее повреждение и становится толще при воспроизведении приливной метки.29 Несмотря на увеличенный объем костной ткани, высокий локальный метаболизм костной ткани и сниженное соотношение кальций:коллаген приводят к недостаточной минерализации кости и снижению модуля упругости костной ткани. Следовательно, механические свойства ухудшаются, и становится легче деформировать кость при механических нагрузках (рис. 1).30, 31

Рисунок 1

Микроструктурные и гистопатологические изменения в субхондральной кости при остеоартрите (ОА). На ранней стадии ОА субхондральная костная пластинка становится тоньше и более пористой, наряду с разрушением субхондральных трабекул и начальной деградацией хряща.На поздних стадиях ОА кальцифицированный хрящ и субхондральная костная пластинка утолщаются, наряду со склеротическими субхондральными трабекулами и прогрессирующей деструкцией хряща. При прогрессировании ОА растущие сосуды и нервы отходят от субхондральной кости в хрящевую. В субхондральной кости при ОА обнаруживаются субхондральные костные кисты, отечные поражения костного мозга и образование остеофитов.

Аномальные клеточные взаимодействия в микроокружении субхондральной кости при ОА

Субхондральная кость при ОА претерпевает разобщение процесса ремоделирования, при котором усиленная резорбция кости, опосредованная остеокластами, и опосредованное остеобластами формирование кости могут проявляться на разных стадиях прогрессирования ОА.32 В норме биомеханическое сцепление суставного хряща и субхондральной кости хорошо известно. На ранней стадии ОА самовосстановление суставного хряща снижает чрезмерную механическую нагрузку на нижележащую субхондральную кость. В результате нагрузка на субхондральную кость падает ниже заданного уровня. В свою очередь, такая недогрузка увеличивает соотношение экспрессии рецептора-активатора лиганда ядерного фактора κB (RANKL)/остеопротегерина (OPG) в остеоцитах, что приводит к избыточному остеокластогенезу и усилению костной резорбционной активности.33, 34 Гиперактивированное ремоделирование кости обычно обнаруживается в местах микроповреждений субхондральной кости у пациентов с ОА и ОА на животных моделях. 35, 36 Остеоциты, непосредственно прилегающие к участкам микроповреждений, подвергаются апоптозу, тогда как остеоциты, прилегающие к апоптотическим популяциям, усиливают экспрессию проостеокластических молекул в ранняя стадия ОА.37,38 Наоборот, остеоциты также регулируют минерализацию остеобластов, активируя сигнальный путь Wnt за счет увеличения продукции белков Wnt и снижения секреции склеростина (SOST) в ответ на повышенную механическую нагрузку, которая вызвана прогрессирующей деструкцией хряща при ОА. при переходе на продвинутую и позднюю стадии.39, 40 Кроме того, in vitro было подтверждено, что трансформирующий фактор роста-β1 (TGF-β1) из остеоцитов может усиливать анаболический метаболизм, опосредованный остеобластами, путем активации Smad2/3 в субхондральной кости на поздних стадиях ОА.41 В результате , сопутствующее увеличение активности остеобластов приводит к пространственной реминерализации и остеосклерозу на конечной стадии ОА.

Параллельно резорбция кости остеокластами приводит к резкому увеличению активного TGF-β1 в субхондральной кости при остеоартрозе, рекрутируя остеопредшественники в участки ремоделирования кости посредством активации пути Smad2/3, что способствует образованию остеоидных островков.42 Аномальное механическое напряжение вызывает нарушение регуляции метаболизма в остеобластах, которое характеризуется повышенной экспрессией интерлейкина (IL)-6, простагландина E2 (PGE2), деградирующей металлопротеиназы матриксной металлопротеиназы (MMP)-3, -9, -13 и RANKL и снижением производство OPG.43 IL-6 и PGE2 стимулируют образование остеокластов, ингибируя секрецию OPG и стимулируя продукцию RANKL в остеобластах или повышая экспрессию RANK в остеокластах.44 Более того, PGE2 способствует секреции IL-6 и в свою очередь, IL-6 способствует секреции PGE2 остеобластами.45 Следовательно, петля положительной обратной связи между передачей сигналов PGE2 и IL-6 способствует дифференцировке остеокластов посредством воздействия на систему OPG/RANKL/RANK. Кроме того, RANKL и фактор роста эндотелия сосудов (VEGF), секретируемые остеобластами в субхондральной кости при ОА, могут запускать хемотаксис остеокластов, индуцируя фосфорилирование внеклеточной регулируемой сигналом киназы 1/2 (ERK1/2) [46–48].

Имеющиеся данные показали, что взаимодействие между клетками линии остеобластов или остеокластов и EC типа H способствует субхондральному ангиогенезу и усугубляет ремоделирование субхондральной кости.49–51 ЭК типа H, окруженные экспрессирующими osterix остеопредшественниками, продуцируют высокие уровни ангиокринных факторов (таких как фактор роста тромбоцитов (PDGF)-A, TGF-β1 и фактор роста фибробластов (FGF)-1), стимулируя выживаемость, пролиферацию и дифференцировка этих остеопредшественников, чтобы способствовать локальному формированию кости. 52, 53 EC типа H взаимодействуют посредством сигнального пути межклеточного Notch/delta-подобного белка 4 (DLL4), чтобы индуцировать продукцию Noggin, 54 который стимулирует дифференцировку остеопредшественников, окружающих сосуды.55 Сосуды типа H также стимулируют миграцию и дифференцировку остеокластов, продуцируя RANKL и MMP-9, которые регулируют ремоделирование кости, чтобы способствовать продольному росту кости. ангиогенные факторы увеличивают количество EC типа H.57–59 Примечательно, что TGF-β1, полученный в результате резорбции остеокластов, в первую очередь отвечает за субхондральный ангиогенез на ранней стадии OA,60 в то время как увеличение PDGF-BB, полученного из преостеокластов, играет относительно преобладающую роль. роль в ангиогенной и остеогенной дифференцировке на поздних стадиях ОА (рис. 2).61

Рисунок 2

Патологические клеточные взаимодействия в субхондральном микроокружении остеоартрита (ОА). (A) На ранней стадии ОА остеоциты усиливают экспрессию соотношения RANKL:OPG для усиления дифференцировки остеокластов. В соответствии с относительной продукцией PGE2, IL-6 и OPG по отношению к RANKL остеобласты разделяют на две подгруппы: «клетки с низким уровнем синтеза» и «клетки с высоким уровнем синтеза». PGE2, IL-6, MMP-9 и VEGF из двух подгрупп опосредуют проостеокластический эффект, в то время как первый действует как первичный эффектор субхондральной потери костной ткани за счет высоких уровней RANKL.Параллельно с этим резорбция кости остеокластами в первую очередь отвечает за ангиогенез и остеогенез за счет высвобождения TGF-β1. Более того, сенсорная иннервация индуцируется H + и Netrin-1, секретируемыми зрелыми остеокластами. RANKL и MMP-9, продуцируемые EC типа H, могут способствовать хемотаксису и образованию остеокластов. (B) На поздней стадии ОА остеоциты регулируют минерализацию остеобластов за счет увеличения количества белков Wnt и TGF-β1 в ответ на повышенную механическую нагрузку. Множественные клетки продуцируют факторы, поддерживающие формирование сосудов типа H, в том числе VEGF и TGF-β1 из остеоцитов, PDGF-BB из преостеокластов и VEGF, TGF-β1 и SLIT3 из остеобластов.Устойчивое разрастание нервов поддерживается NGF из преостеокластов и PGE2 из остеобластов. Последняя подгруппа способствует склерозу субхондральной кости, в первую очередь регулируемому ангиокринными факторами (PDGF-A, TGF-β1 и FGF-1). ASIC, кислоточувствительный ионный канал; DCC, удаленный при раке толстой кишки; DLL4, дельта-подобный белок 4; DP1R, рецептор DP1; ИЛ-6, интерлейкин-6; ММР-9, матриксная металлопротеиназа-9; PDGF, тромбоцитарный фактор роста; ПГ, простагландин; RANKL, активатор рецептора лиганда NF-κB; SLIT3, лиганд 3 для наведения щели; SOST, склеростин; TGF-β1, трансформирующий фактор роста-β1; TRPV1, переходный рецепторный потенциал ваниллоида 1; VEGF, фактор роста эндотелия сосудов.

Ненадежная жизнь с ревматоидным артритом – мегаэтнография из девяти синтезов качественных данных | BMC Rheumatology

  • ArthrisResearchUK: State of Musculoskeletal Health file:///C:/Users/toyef/Downloads/PHS-08_StateOfMSKReportpdf 2018 (1 ноября 2018 г.).

  • Хантер Т.М., Бойцов Н.Н., Чжан Х., Шредер К., Мишо К., Араужо А.Б. Распространенность ревматоидного артрита среди взрослого населения США в базах данных медицинских заявлений, 2004–2014 гг.Ревматол Интерн. 2017;37(9):1551–157.

    ПабМед Статья Google ученый

  • Кэмпбелл Р., Паунд П., Морган М., Дакер-Уайт Г., Бриттен Н., Пилл Р., Ярдли Л., Поуп К., Донован Дж. Оценка метаэтнографии: систематический анализ и синтез качественных исследований. Оценка медицинских технологий. 2011;15:43.

    Артикул Google ученый

  • Диксон-Вудс М., Бут А., Саттон А.Синтез качественных исследований: обзор опубликованных отчетов. Качественное разрешение 2007; 7: 375–422.

    Артикул Google ученый

  • Ханнес К., Макайтис К. Переход к более систематическим и прозрачным подходам к синтезу качественных данных: обновленная информация об обзоре опубликованных статей. Качественное разрешение 2012;12(4):402–42.

    Артикул Google ученый

  • Той Ф., Сирс К., Ханнинк Э., Баркер К.Мегаэтнография одиннадцати качественных доказательств, исследующих опыт жизни с хронической доброкачественной болью. БМС Мед Рез Методол. 2017;17:116. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5540410/pdf/12874_2017_Article_392.pdf.

    ПабМед ПабМед Центральный Статья Google ученый

  • Фрост Дж., Гарсайд Р., Купер С., Бриттен Н. Мета-исследование как диагностика: к содержанию вместо формы в качественном синтезе.Качество здоровья Res. 2016;26(3):307–19.

    ПабМед Статья Google ученый

  • Той Ф., Сирс К., Эванс П., Рис С., Чутер А., Оллкок Н., Карр Э., Баркер К.: Включая качественные исследования в обучении боли. https://ebooks.iasp-pain.org/pain_education/.

  • Ноблит Г., Хэйр Р. Метаэтнография: синтез качественных исследований. Калифорния: публикации Sage; 1988.

    Книга Google ученый

  • Тонг А., Флемминг К., Макиннес Э., Оливер С., Крейг Дж.Повышение прозрачности отчетности по синтезу качественных исследований: ENTREQ. БМС Мед Рез Методол. 2012;12(181).

  • Вонг Г., Гринхал Т., Вестхорп Г., Букингем Дж., Поусон Р. Стандарты публикаций РАМИЗ: реалистический синтез. БМС Мед. 2013; 11:21 https://doi.org/10.1186/1741-7015-1111-1121.

  • Франция EF, Ring N, Noyes J, Maxwell M, Jepson R, Duncan E, Turley R, Jones D, Uny I. Руководство по составлению протоколов по метаэтнографии (eMERGe). БМС Мед Рез Методол.2015;15:103.

  • Манн З., Порритт К., Локвуд С., Ароматарис Э., Пирсон А. Установление уверенности в результатах синтеза качественных исследований: подход ConQual. БМС Мед Рез Методол. 2014; 14:108 http://www.biomedcentral.com/1471-2288/1414/1108.

    ПабМед ПабМед Центральный Статья Google ученый

  • Левин С., Глентон С., Мунте-Каас Х., Карлсен Б., Колвин С.Дж., Гюльмезоглу М., Нойес Дж., Бут А., Гарсайд Р., Рашидиан А.Использование качественных данных при принятии решений в отношении медицинских и социальных вмешательств: подход к оценке достоверности результатов синтеза качественных данных (GRADE-CERQual). ПЛОС Медицина. 2016;12(10):e1001895. 10.01810.1001371/журнал. пмед.1001895.

    Артикул Google ученый

  • Noyes J, Booth A, Lewin S, Carlsen B, Glenton C, Colvin CJ, Garside R, Bohren MA, Rashidian A, Wainwright M, et al. Применение GRADE-CERQual к результатам синтеза качественных данных – документ 6: как оценить релевантность данных.Реализовать науч. 2018;13(доп.1):4.

    ПабМед ПабМед Центральный Статья Google ученый

  • Munthe-Kaas H, Bohren M, Glenton C, Lewin S, Noyes J, Tuncalp Ö, Booth A, Garside R, Colvin C, Wainwright M, et al. Применение GRADE-CERQual к результатам синтеза качественных данных — документ 3: как оценить методологические ограничения. Реализовать науч. 2018;13(доп.1):9.

    ПабМед ПабМед Центральный Статья Google ученый

  • Левин С., Бут А., Глентон С., Мунте-Каас Х., Рашидиан А., Уэйнрайт М., Борен М., Тунсалп О., Колвин С., Гарсайд Р. и др.Применение GRADE-CERQual к результатам синтеза качественных доказательств: введение в серию. Реализовать науч. 2018;13(Приложение 1):2.

    ПабМед ПабМед Центральный Статья Google ученый

  • Левин С., Борен М., Рашидиан А., Мунте-Каас Х., Глентон С., Колвин С., Гарсайд Р., Нойес Дж., Бут А., Тунсалп О. и др. Применение GRADE-CERQual к результатам синтеза качественных данных — документ 2: как провести общую оценку достоверности CERQual и создать сводную таблицу качественных результатов.Реализовать науч. 2018;13(доп 1):10.

    ПабМед ПабМед Центральный Статья Google ученый

  • Глентон С., Карлсен Б., Левин С., Мунте-Каас Х., Колвин С.Дж., Тунсалп О., Борен М.А., Нойес Дж., Бут А., Гарсайд Р. и др. Применение GRADE-CERQual к результатам синтеза качественных данных — документ 5: как оценить адекватность данных. Реализовать науч. 2018;13(доп.1):14.

    ПабМед ПабМед Центральный Статья Google ученый

  • Колвин С., Гарсайд Р., Уэйнрайт М., Мунте-Каас Х., Глентон С., Борен М., Карлсен Б., Тунсалп О., Нойес Дж., Бут А. и др.Применение GRADE-CERQual к результатам синтеза качественных данных — документ 4: как оценить согласованность. Реализовать науч. 2018;13(доп.1):13.

    ПабМед ПабМед Центральный Статья Google ученый

  • Бут А., Левин С., Глентон С., Мунте-Каас Х., Тэйвс И., Нойес Дж., Рашидиан А., Берг Р.С., Ньяканго Б., Меерпох Дж.Дж. и др. Применение GRADE-CERQual к результатам синтеза качественных данных – документ 7: понимание потенциальных последствий предвзятости распространения.Реализовать науч. 2018;13(доп. 1):12.

    ПабМед ПабМед Центральный Статья Google ученый

  • Той Ф., Сирс К., Оллкок Н., Бриггс М., Карр Э., Эндрюс Дж., Баркер К. Метаэтнография переживаний пациентов с хронической доброкачественной мышечно-скелетной болью. Исследование предоставления медицинских услуг. 2013;1(12):1–189.

    Артикул Google ученый

  • Той Ф., Сирс К., Олкок Н., Бриггс М., Карр Э., Баркер К.Метаэтнография 25 лет спустя: проблемы и идеи для синтеза большого количества качественных исследований. БМС Мед Рез Методол. 2014;14:80.

    ПабМед ПабМед Центральный Статья Google ученый

  • Тавори И., Тиммерманс С. Абдуктивный анализ – теоретизирование качественного исследования. Чикаго: Издательство Чикагского университета; 2014.

    Книга Google ученый

  • Поуп К., Мэйс Н., Попай Дж. Синтез качественных и количественных исследований в области здравоохранения: руководство по методам.Беркшир, Великобритания: Издательство Открытого университета; 2007.

  • Той Ф., Сирс К., Оллкок Н., Бриггс М., Карр Э., Эндрюс Дж., Баркер К. «Попытка определить желе» – исследование интуитивных процессов в оценке качества для метаэтнографии. БМС Мед Рез Методол. 2013;13:46.

    ПабМед ПабМед Центральный Статья Google ученый

  • Той Ф., Сирс К., Оллкок Н., Бриггс М., Карр Э., Баркер К. Синтез качественных исследований, изучающих барьеры для продолжения работы с хронической скелетно-мышечной болью.Реабилитация инвалида. 2016;38(6):566–72.

    ПабМед Статья Google ученый

  • Snelgrove S, Liossi C. Жизнь с хронической болью в пояснице: метасинтез качественных исследований. Хроническое заболевание. 2013;9(4):283–301.

    ПабМед Статья Google ученый

  • Sim J, Madden S. Опыт болезни при синдроме фибромиалгии: метасинтез качественных исследований.Социальная научная медицина. 2008;67(1):57–67.

    Артикул Google ученый

  • Парсонс С., Хардинг Г., Брин А., Фостер Н., Пинкус Т., Фогель С., Андервуд М. Влияние убеждений и ожиданий пациентов и врачей первичной медико-санитарной помощи в отношении хронической скелетно-мышечной боли на процесс лечения: систематический обзор качественных исследований. Клин Джей Пейн. 2007;23(1):91–8.

    ПабМед Статья Google ученый

  • Monsivais DB, Engebretson JC.Культурные сигналы: обзор качественных доказательств ориентированного на пациента ухода за пациентами с незлокачественной хронической болью. Реабилитация Нурс. 2011;36(4):166–71.

    ПабМед Статья Google ученый

  • Mengshoel A, Sim J, Ahlsen B, Madden S. Диагностический опыт пациентов с фибромиалгией – метаэтнография. Хроническое заболевание. 2017;14(3):194–211.

    ПабМед Статья Google ученый

  • Макнила П., Дойл К., О’Горман Д., Руан Н., Макгуайр Б.Э.Переживания хронической боли в пояснице: метаэтнография качественного исследования. Health Psychol Rev. 2015; 9 (1): 63–82.

    ПабМед Статья Google ученый

  • Hopayian K, Notley C. Систематический обзор ожиданий и опыта пациентов с болью в пояснице и ишиасом от медицинской помощи. Spine J. 2014;14(8):1769–80.

    ПабМед Статья Google ученый

  • Fu Y, McNichol E, Marczewski K, Closs SJ.Партнерство между пациентом и специалистом и самоконтроль хронической боли в спине: качественный систематический обзор и обобщение. Сообщество здравоохранения. 2016;24(3):247–59.

    ПабМед Статья Google ученый

  • Фроуд Р., Андервуд М., Паттерсон С., Элдридж С., Сил С., Пинкус Т., Раджендран Д., Фоссум С. Систематический обзор и мета-синтез влияния боли в пояснице на жизнь людей. BMC Расстройство опорно-двигательного аппарата. 2014;15:1.

    Артикул Google ученый

  • Кроу М., Уайтхед Л., Ситон П., Джордан Дж., МакКолл С., Маскилл В., Трип Х.Качественный метасинтез: переживание хронической боли при различных состояниях. J Ад Нурс. 2016;73(5):1004–16.

    ПабМед Статья Google ученый

  • Банзли С., Уоткинс Р., Смит А., Шютце Р., О’Салливан П. Жизнь в ожидании: качественный синтез, исследующий опыт хронической боли в пояснице. Клин Джей Пейн. 2013;29(10):907–16.

    ПабМед Статья Google ученый

  • Той Ф., Сирс К., Баркер К.Метаэтнография переживаний пациентов с хронической тазовой болью: попытки сконструировать хроническую тазовую боль как «настоящую». J Ад Нурс. 2014;70(12):2713–27.

    ПабМед Статья Google ученый

  • Соуза П.П., Салата Ромао А., Роза ESJC, Кандидо душ Рейс Ф., Ногейра А.А., Поли-Нето О.Б. Качественное исследование как основа биопсихосоциального подхода к женщинам с хронической тазовой болью. J Psychosom Obstet Gynecol. 2011;32(4):165–72.

    Артикул Google ученый

  • Докерти Т., Латам С.К., Смит Т.О. Почему пациенты не принимают анальгетики? Метаэтнография, оценивающая восприятие приверженности лечению у пациентов с остеоартритом. Ревматол Интерн. 2016;36(5):731–9.

    КАС пабмед Статья Google ученый

  • Смит Т.О., Парди Р., Листер С., Солтер С., Флиткрофт Р., Конаган П.Жизнь с остеоартритом: систематический обзор и метаэтнография. Scand J Ревматол. 2014;43(6):441–52.

    КАС пабмед Статья Google ученый

  • Смит Т.О., Солтер С., Флиткрофт Р., Парди Р., Листер С., Конаган П.Г. Отношение людей с остеоартритом к их консервативному лечению: систематический обзор и метаэтнография. Ревматол Интерн. 2014;34(3):299–313.

    ПабМед Статья Google ученый

  • Паскинс З., Сандерс Т., Хасселл А.Б.Сравнение опыта пациентов на консультации по поводу остеоартрита с отношением и убеждениями врачей общей практики к ОА: описательный обзор. BMC Fam Pract. 2014;15:46.

    ПабМед ПабМед Центральный Статья Google ученый

  • Кроу М., Гиллон Д., Джордан Дж., МакКолл С. Стратегии пожилых людей в борьбе с хронической доброкачественной болью: качественный метасинтез. Int J Nurs Stud. 2017;68:40–50.

    ПабМед Статья Google ученый

  • Вайсморади М., Скэр Л., Седерберг С., Бондас Т.Е.Нормализация страданий: метасинтез опыта и взглядов на боль и лечение боли в домах престарелых. Int J Qual Stud Здоровье и благополучие. 2016;11:31203.

    ПабМед Статья Google ученый

  • Баркер К., Той Ф., Лоу К.: Качественный систематический обзор опыта пациентов с остеопорозом с использованием метаэтнографии. Арх Остеопорос 2016, 11 (1): 1–13.

  • Бомбак А.Е., Хэнсон Х.М. Качественные выводы из исследований остеопороза: описательный обзор литературы.Дж Остеопорос. 2016;2016.

  • Тонг А., Джонс Дж., Крейг Дж.С., Синг-Гревал Д. Опыт жизни детей с ювенильным идиопатическим артритом: тематический синтез качественных исследований. Уход за артритом Рез. 2012;64(9):1392–404.

    Артикул Google ученый

  • Bennion AE, Molassiotis A. Качественное исследование симптомов у взрослых больных раком после лечения: систематический обзор и метасинтез.Поддержите уход за раком. 2013;21(1):9–25.

    КАС пабмед Статья Google ученый

  • Флемминг К. Использование морфина для лечения боли, связанной с раком: синтез количественных и качественных исследований. J Управление симптомами боли. 2010;39(1):139–54.

    КАС Статья Google ученый

  • Хиггинс К.С., Бирни К.А., Чемберс К.Т., Кларк А.Дж., Линч М., Кэмпбелл-Йео М., Уилсон А.С., Кейс Л., Стинсон Дж.Потомство родителей с хронической болью: систематический обзор и метаанализ результатов боли, здоровья, психологии и семьи. Боль. 2015;156(11):2256–66.

    ПабМед ПабМед Центральный Статья Google ученый

  • Эгертон Т., Даймонд Л.Э., Беннелл К.Л., Бухбиндер Р., Слэйд СК. Систематический обзор и обобщение данных качественных исследований для выявления препятствий и факторов, препятствующих лечению остеоартрита у клиницистов первичного звена.Остеоартрит хрящ. 2017;25(5):625–38.

    КАС пабмед Статья Google ученый

  • Gardner T, Refshauge K, Smith L, McAuley J, Hübscher M, Goodall S. Убеждения и взгляды физиотерапевтов влияют на клиническую практику при хронической боли в пояснице: систематический обзор количественных и качественных исследований. J физ. 2017;63(3):132–43.

    Google ученый

  • Слейд С.К., Кент П., Патель С., Бакнолл Т., Бухбиндер Р.Барьеры для приверженности клиницистов первичной медико-санитарной помощи клиническим рекомендациям по лечению болей в пояснице: систематический обзор и метасинтез качественных исследований. Клин Джей Пейн. 2016;32(9):800–16.

    ПабМед Статья Google ученый

  • Synnott A, O’Keeffe M, Bunzli S, Dankaerts W, O’Sullivan P, O’Sullivan K. Физиотерапевты могут стигматизировать или чувствовать себя неподготовленными к лечению людей с болью в пояснице и психосоциальными факторами, влияющими на выздоровление: систематический рассмотрение.J физ. 2015;61(2):68–76.

    Google ученый

  • Той Ф., Сирс К., Баркер К.: метаэтнография для понимания опыта медицинских работников в лечении взрослых с хронической доброкачественной болью. БМЖ открыт. 2017;7(12). https://bmjopen.bmj.com/content/bmjopen/7/12/e018411.full.pdf.

  • Той Ф., Сирс К., Тирни С., Баркер К.: синтез качественных данных для изучения опыта медицинских работников по назначению опиоидов взрослым с хронической доброкачественной болью.Семейная практика BMC. 2017;18(94). https://bmcfampract.biomedcentral.com/track/pdf/10.1186/s12875-017-0663-8.

  • Стек Р.Дж., Сахни М., Раза К., Маллен К.Д. Симптомокомплексы на ранних стадиях ревматоидного артрита: обобщение качественной литературы. Уход за артритом Рез. 2013;65(12):1916–26.

    Артикул Google ученый

  • Stack R, Shaw K, Mallen C, Herron-Marx S, Horne R, Raza K. Задержки в обращении за помощью при появлении симптомов ревматоидного артрита: систематический синтез качественной литературы.Энн Реум Дис. 2011;71(4):493–7.

    ПабМед Статья Google ученый

  • Ховинг Дж.Л., ван Цвитен МКБ, ван дер Меер М., Слютер Дж.К., Фрингс-Дрезен М.Х.В. Участие в работе и артрит: систематический обзор проблем, адаптации и возможностей для вмешательств. Ревматология (Оксфорд). 2013;52(7):1254–64.

    Артикул Google ученый

  • Феддерсен Х., Кристиансен Т.М., Андерсен П.Т., Хёрслев-Петерсен К., Примдал Дж.Конструирование значимых идентичностей в контексте ревматоидного артрита, материнства и оплачиваемой работы: метаэтнография. Джей Клин Нурс. 2017.

  • Дакер-Уайт Г., Донован Дж., Кэмпбелл Р. Новое определение болезни: метаэтнография качественных исследований опыта ревматоидного артрита. Реабилитация инвалида. 2014;36(13):1061–71.

    ПабМед Статья Google ученый

  • Кэмпбелл Р., Паунд П., Морган М., Дакер-Уайт Г., Бриттен Н., Пилл Р., Ярдли Л., Поуп К., Донован Дж.Оценка метаэтнографии: систематический анализ и синтез качественных исследований. Оценка медицинских технологий. 2011;15(43):1–164.

    КАС пабмед Статья Google ученый

  • Лин В-К, Гау М-Л, Лин Х-К, Лин Х-Р. Духовное благополучие у больных ревматоидным артритом. Журнал сестринских исследований: JNR. 2011;19(1):1–12.

  • Келли А., Тиммс К., Танниклифф Д.Дж., Самптон Д., Перера С., Фэллон К., Крейг Дж.С., Абхаяратна В., Тонг А.Отношение и опыт пациентов к модифицирующим заболевание противоревматическим препаратам при ревматоидном артрите и спондилоартрите: качественный синтез. Уход за артритом Рез. 2017;70(4):525–32.

  • Хулен Э., Эрвин А., Шу А., Эванс-Янг Г., Саха С., Елин Э.Х., Бартон Дж.Л. Цели пациентов при лечении ревматоидного артрита: систематический обзор и качественный синтез. Опорно-двигательный аппарат. 2016;15(4):295–303.

  • Франция EF, Ring N, Thomas R, Noyes J, Maxwell M, Jepson R.Методологический систематический обзор того, что не так с отчетами о метаэтнографии. БМС Мед Рез Методол. 2014;14:119.

    ПабМед ПабМед Центральный Статья Google ученый

  • Батлер Дж. Перформативность, ненадежность и сексуальная политика. Revista de Antropología Iberoamericana. 2009;4(3). https://www.aibr.org/antropologia/04v03/criticos/040301b.pdf.

  • Икин Дж., Михайловский Э. Переосмысление оценки качественного здоровья: размышления об обзоре руководящих принципов оценки в науках о здоровье.J Eval Clin Pract. 2003;9(2):187–94.

    ПабМед Статья Google ученый

  • Барбур Р. Контрольные списки для повышения строгости качественных исследований: случай, когда хвост виляет собакой? Бр Мед Дж. 2001;322:1115–7.

    КАС Статья Google ученый

  • CRD: Центр обзоров и распространения. Систематические обзоры — руководство CRD по проведению обзоров в сфере здравоохранения.В. Под редакцией Распространения CfRa, vol. https://www.york.ac.uk/media/crd/Systematic_Reviews.pdf. Йоркский университет: York Publishing Services Limited; 2009.

  • Той Ф., Сирс К., Баркер К.: Метаэтнография опыта медицинских работников по лечению взрослых с хронической доброкачественной болью для улучшения опыта и качества здравоохранения. Библиотека журналов NIHR. 2018;6(17). https://www.journalslibrary.nihr.ac.uk/programmes/hsdr/1419807#/.

  • Той Ф., Сирс К., Баркер К.Метаэтнография переживаний пациентов с хронической тазовой болью: попытка сконструировать хроническую тазовую боль как «настоящую». J Ад Нурс. 2014;70(12):2713–27.

    ПабМед Статья Google ученый

  • Блумер Х. Что не так с социальной теорией. Am Sociol Rev. 1954; 18: 3–10.

    Артикул Google ученый

  • Физические пределы клеточной миграции: Контроль с помощью пространственной и ядерной деформации ВКМ и настройка с помощью протеолиза и силы растяжения | Журнал клеточной биологии

    3D-гидрогели были воссозданы либо из телопептид-интактного ковалентно сшитого коллагена после кислотной экстракции сухожилия хвоста крысы, либо из бычьего дермального коллагена с восстановленным телопептидом и поперечными связями после обработки кислотой и пепсином (Wolf et al., 2003а; Сабех и др., 2004 г.; Содек и др., 2007; Паккард и др., 2009). Равные концентрации коллагена (1,7 мг/мл) сравнивали по скорости сборки, структуре фибрилл, пористости и жесткости матрицы. Для контролируемых условий культивирования и визуализации матрицы были закреплены с использованием специальной стеклянной камеры (рис. S1 A). Время до полимеризации, отслеживаемое с помощью конфокальной микроскопии обратного рассеяния при 37°C, показало 16-кратное ускорение сборки крысиного хвоста (половина максимальной полимеризации через 30 с) по сравнению с бычьим дермальным коллагеном (8 мин; рис.1 А). Различные скорости сборки согласуются с разным содержанием телопептидов в препаратах коллагена (Helseth and Veis, 1981; Sabeh et al., 2009). Архитектура фибриллярного матрикса, обнаруженная с помощью конфокальной отражательной микроскопии, была подтверждена с помощью иммунофлуоресценции коллагена I типа, что подтверждает незначительную ошибку обнаружения фибрилл без обратного рассеяния в вертикальной ориентации (ниже 3% пикселей, содержащих сигнал; рис. S1, B). –D; Джаверт и др., 2010). В то время как коллаген, полученный из сухожилий крысы, образовывал тонкие фибриллы диаметром 20 нм и узким диапазоном размеров пор 2–5 мкм 2 (диаметр пор 1–2 мкм), коллагеновые матрицы, полученные из бычьей дермы, состояли из фибрилл с диаметром 60 нм и поперечным сечением пор от 6 до 30 мкм 2 (диаметр пор 2–6 мкм; рис.1 Б, Д, Д; Рис. S2 A, B, D и E). Количество фрактальных ящиков, измеренное как содержащие фибриллы поля с уменьшающейся длиной стороны, было в два-три раза выше для коллагена из хвоста крысы по сравнению с бычьим коллагеном с соответствующей концентрацией (рис. S2, C и F). Для контроля изменений жесткости решетки коллагена, зависящих от плотности фибрилл, использовали атомно-силовую микроскопию (АСМ) с шариком размером 10 мкм в качестве зонда для приблизительного определения размера клетки. Поверхность решетки неоднократно исследовалась кантилевером (рис. S1 A), и проникновение шарика и усилие регистрировались совместно (рис.1С, слева). В соответствии с предыдущими сообщениями, АСМ выявил вдвое более низкий модуль упругости бычьей дермы по сравнению с коллагеном хвоста крысы при 1,7 мг/мл (28 против 51 Па; рис. 1C, справа; Stein et al., 2008; Yang and Kaufman, 2009). Таким образом, хотя препараты коллагена восстановлены в эквивалентных концентрациях, они существенно различаются по диаметру фибрилл и межфибриллярному пространству, а также умеренно по жесткости сети.

    Pex11 опосредует пролиферацию пероксисом, способствуя деформации липидной мембраны | Биология открытый

    Белки семейства

    Pex11p играют ключевую роль в делении пероксисом, но их молекулярные механизмы в основном остаются неизвестными.В настоящем исследовании сверхэкспрессия Pex11pβ вызывала существенную везикуляцию пероксисом в клетках млекопитающих. Это образование везикул зависело от динаминоподобного белка 1 (DLP1) и фактора деления митохондрий (Mff), поскольку нокдаун этих белков уменьшал деление пероксисом после избыточной экспрессии Pex11pβ. Дефицитные по делению пероксисомы проявляли удлиненную морфологию, и белки-маркеры пероксисом, такие как Pex14p или белки матрикса, несущие пероксисомальный сигнал-мишень 1, были различимы в сегментированном паттерне окрашивания, подобно бусинкам на нити.Эндогенный Pex11pβ также имел полосатую структуру, но не совпадающую с белками матрикса Pex14p и PTS1. Изменение морфологии липидной мембраны наблюдалось при введении рекомбинантных белков Pex11p в протеолипосомы. Констрикция протео-липосом наблюдалась при конфокальной микроскопии и электронной микроскопии, а реконструированный белок Pex11pβ локализовался в месте сужения мембраны. Введение точечных мутаций в N-концевую амфифатическую спираль Pex11pβ сильно уменьшало деление пероксисом и уменьшало образование олигомеров.Эти результаты указывают на то, что Pex11p вносит вклад в морфогенез пероксисомальной мембраны, которая необходима для последующего деления с помощью DLP1.

    Пероксисомы представляют собой одиночные мембраносвязанные органеллы, которые участвуют в окислении длинноцепочечных жирных кислот, синтезе плазмалогена и элиминации АФК (van den Bosch et al., 1992; Wanders and Waterham, 2006). Пероксисомы поддерживаются за счет автономной пролиферации. Пролиферация пероксисом может происходить за счет роста и деления ранее существовавших пероксисом или синтеза de novo (Lazarow and Fujiki, 1985; Thoms and Erdmann, 2005; Hettema and Motley, 2009).Структура пероксисомальной мембраны нарушена в фибробластах пациентов с синдромом Зеллвегера, и этот эффект можно обратить введением соответствующих генных продуктов (Honsho et al., 1998; Matsuzono et al., 1999; South and Gould, 1999; Ghaedi et al. , 2000; Muntau et al., 2000; Shimozawa et al., 2000).

    Хорошо известно, что пероксисомы поддерживаются путем роста и деления (Lazarow and Fujiki, 1985). Была предложена многостадийная реакция для этого процесса (Schrader et al., 1998; Кох и др., 2003; Ли и Гулд, 2003). Во-первых, в пероксисомы импортируются белки пероксисомного матрикса и мембранные белки. Во-вторых, пероксисомы увеличиваются в размерах и приобретают удлиненную морфологию. Белки-маркеры пероксисом обнаруживались в виде сегментов на таких удлиненных пероксисомах, как бусинки на нитке, с перетяжкой мембраны (Grabenbauer et al., 2000; Koch et al., 2004; Itoyama et al., 2012; Itoyama et al. , 2013). Затем мембрана расщепляется по сайтам рестрикции с образованием новых пероксисом.Было идентифицировано несколько белков, участвующих в этом конечном процессе. Dynamin-подобный белок 1 (DLP1) представляет собой большую цитозольную GTPase, принадлежащую к суперсемейству динаминов (Praefcke and McMahon, 2004). Считается, что DLP1 полимеризуется в месте деления, позволяя расщеплять мембрану посредством гидролиза GTP (Yoon et al., 2001; Zhu et al., 2004). Fission 1 (Fis1) и митохондриальный фактор деления (Mff) были идентифицированы как мембранный рецептор для DLP1 (Kobayashi et al., 2007; Gandre-Babbe and van der Bliek, 2008; Otera et al., 2010; Итояма и др., 2013). Нокдаун или мутация DLP1, Fis1 и Mff приводит к образованию удлиненных пероксисом с дефицитом деления (Koch et al., 2003; Koch et al., 2004; Koch et al., 2005; Tanaka et al., 2006; Kobayashi et al. ., 2007; Waterham et al., 2007; Gandre-Babbe and van der Bliek, 2008; Otera et al., 2010; Itoyama et al., 2013). Было показано, что эти факторы играют важную роль в делении митохондрий, а также в пролиферации пероксисом (Koch et al., 2005; Tanaka et al., 2006; Waterham et al., 2007; Gandre-Babbe and van der Bliek, 2008; Otera et al. ., 2010). Однако сферические пероксисомы требуют стадий удлинения перед делением (Itoyama et al., 2012), чего нет у митохондрий.

    Считается, что белки семейства

    Pex11p функционируют на стадии элонгации мембраны (Schrader et al., 1998; Li and Gould, 2002). Белки Pex11p представляют собой пероксисомальные мембранные белки, состоящие из трех изоформ в клетках млекопитающих: Pex11pα (Abe et al., 1998; Li et al., 2002b), Pex11pβ (Abe and Fujiki, 1998; Schrader et al., 1998; Li et al., 2002a) и Pex11pγ (Li et al., 2002b; Tanaka et al., 2003). Pex11pβ является наиболее хорошо охарактеризованной изоформой из-за ее повсеместной экспрессии и участия в делении пероксисом. Сверхэкспрессия Pex11pβ приводит к ускорению деления пероксисом, а мыши с нокаутом Pex11pβ имеют уменьшенное количество пероксисом (Schrader et al., 1998; Li et al., 2002a; Kobayashi et al., 2007). Pex11pβ представляет собой гомо- или гетероолигомерный белок с N-концевой амфипатической спиралью (Kobayashi et al., 2007; Опалински и др., 2011; Бонекамп и др., 2013). У дрожжей синтетический пептид, соответствующий этому спиральному участку, может напрямую связываться с липосомами и нарушать их структуру, что приводит к образованию трубчатых образований (Opaliński et al., 2011). Также сообщается, что Pex11pβ взаимодействует с DLP1 посредством связывания с Fis1 или Mff (Kobayashi et al., 2007; Koch and Brocard, 2012; Itoyama et al., 2013). Введение меченного EGFP или YFP Pex11pβ способствовало делению пероксисом и приводило к образованию кластеров удлиненных пероксисом (Delille et al., 2010; Кох и др., 2010). Хотя эти данные свидетельствуют о том, что Pex11pβ играет фундаментальную роль в морфогенезе пероксисом, характеристики Pex11pβ полностью не выяснены, особенно в отношении его роли в деформации мембраны.

    В настоящей работе мы охарактеризовали роль Pex11pβ в пероксисомальном морфогенезе в клетках млекопитающих. Локализация эндогенного Pex11pβ была проанализирована в клетках с дефицитом деления, что выявило чередующийся характер окрашивания Pex11pβ и Pex14p/PTS1.Также было протестировано влияние Pex11pβ на морфологию искусственных липидных мембран. Pex11pβ изменяет морфологию восстановленных протео-липосом способом, который зависит от N-концевой амфипатической спирали. В этом анализе in vitro рекомбинантные белки Pex11pα и Pex11pγ также были эффективны в морфологии мембраны липосом из-за свойства амфипатической спирали. Нокдаун PEX11β уменьшал количество пероксисом. В этом анализе in vivo Pex11pγ оказывал такое же влияние на образование пероксисом, как и Pex11pβ, но Pex11pα оказывал незначительное влияние.Эти результаты убедительно демонстрируют, что Pex11p функционирует в морфогенезе пероксисом, особенно на стадиях удлинения и сужения.

    Наша группа ранее показала, что N-концевая цитозольная область Pex11pβ необходима для ее способности усиливать пероксисомальное деление (Kobayashi et al., 2007), а другая группа сообщила, что синтетический пептид, соответствующий N-концевой амфипатической спирали Pex11pβ индуцирует образование трубчатых структур из искусственных мембран in vitro (Opaliński et al., 2011). Было показано, что эта деформирующая мембрану активность зависит от амфипатических свойств α-спиральной структуры Pex11pβ за счет введения точечных мутаций в ее последовательность. Поэтому мы создали соответствующие мутантные формы Pex11pβ человека. Мутируемую область выбирали путем измерения гидрофобного момента с помощью Heliquest (см. Материалы и методы). В гидрофобную поверхность амфипатического участка вводили отрицательно заряженные аминокислоты для изменения общего заряда этого участка без изменения его α-спиральной структуры (Pex11pβ-φ) или также вводили остатки пролина, чтобы препятствовать образованию α-спирали ( Pex11pβ-P) (фиг.3А). Используя множественное выравнивание последовательностей белков Pex11p разных видов и трех изоформ человека, были определены амфипатические спирали в Pex11pα, Pex11pβ и Pex11pγ человека (дополнительный материал, рис. S4A, подчеркивание). Среднее значение гидрофобного момента в этой области составляло 0,342 для Pex11pα, 0,359 для Pex11pβ и 0,501 для Pex11pγ (дополнительный материал, рис. S4B, черная линия). Для подтверждения эффекта точечные мутации Myc-Pex11pβ-φ и Myc-Pex11pβ-P были сверхэкспрессированы в клетках HeLa, и клетки были подвергнуты иммуноокрашиванию с использованием антител к Myc и Pex14p (рис.3Б). В то время как Myc-Pex11pβ дикого типа усиливал деление пероксисом, как показано на рис.   1A, сверхэкспрессия мутантных форм не изменяла количество пероксисом в клетках HeLa (дополнительный материал, рис. S2C). Также было исследовано влияние Pex11pα и Pex11pγ на деление пероксисом. Оба изомера Pex11p слабо влияли на деление. Свойства деления ряда белков Pex11p также были протестированы в клетках, в которых DLP1 были нокдауны. Pex11pβ и Pex11pγ дикого типа были включены в пероксисомы, образуя области, обогащенные Myc-Pex11p, и увеличивая удлинение пероксисом в целом, в то время как мутанты Pex11pβ и Pex11pα не приводили к дополнительному удлинению пероксисом (дополнительный материал, рис.С2Е). Затем, как Pex11pβ дикого типа (рис. 2C), мутантные белки Pex11pα и Pex11pγ очищали и воссоздавали в протеолипосомы для определения влияния этих белков на морфологию липосом. В качестве контрольного эксперимента также исследовали типичный белок пероксисомальной мембраны Pex14p. Pex14p сильно осаждался в отсутствие липосом, поэтому восстановление проводили методом плавания, как показано в дополнительном материале на рис. S3. При конфокальной микроскопии все изомеры Pex11p проявляли липосомальную агрегационную активность в той или иной степени, в то время как мутанты Pex11pβ и Pex14p не оказывали влияния на восстановленные протеолипосомы (рис.3Ca–е). Восстановление этих белков оценивали вестерн-блоттингом в осажденных липосомах (рис.   3Cg). Гистограмма распределения размеров всех восстановленных протео-липосом показана на рис. 3D. Процент агрегированных липосом (более 0,3 мкм 2 ) резко увеличился, когда Pex11pβ был преобразован в протеолипосомы. Аналогичным образом наблюдалось увеличение в протеолипосомах, восстановленных с помощью Pex11pα и Pex11pγ. Pex14p и мутантные формы Pex11pβ не влияли на процент крупных липосомальных кластеров.

    Для детального изучения морфологии липосом использовали электронную микроскопию с отрицательным окрашиванием. Контрольная обработка липосом не влияла на их морфологию, в то время как восстановление липосом с помощью Pex11pβ вызывало скопление мелких везикул, что наблюдалось при конфокальной микроскопии (рис.   6Aa–d). Когда Pex11pγ был включен в липосомы, липосомы образовывали небольшие агрегаты (рис. 6Bd).Мутантные формы Pex11pβ не влияли на кластеризацию липосом (рис.   6Ba,b), однако Pex11pα реконструировал липосомы, слегка расширяясь (рис. 6Bc), что согласуется с результатами, показанными на рис.   3C, D. Локализация восстановленного Pex11pβ была обнаружена с помощью иммунного окрашивания с использованием антитела против Pex11pβ и мечения иммунозолотом. Частицы золота были обнаружены в местах контакта между небольшими везикулами в липосомах, восстановленных Pex11pβ (рис. 6Ca, стрелки), в то время как иммунозолото было обнаружено на гладкой поверхности малых липосом в липосомах, восстановленных Pex11pβ-P (рис.6Сб). Контрольные липосомы не показали значительного сигнала (рис.   6Cc). Затем восстановленные липосомы подвергли ультратонкой электронной микроскопии (рис. 6D). Контрольные липосомы и реконструированные Pex11pβ липосомы концентрировали ультрацентрифугированием, затем фиксировали глутаровым альдегидом и заключали в эпон. В контрольных образцах небольшие липосомы диспергировали отдельно. Напротив, в образцах, восстановленных Pex11pβ, наблюдались небольшие кластеры связанных липосом. Липосомы были связаны друг с другом и, по-видимому, были сужены в местах контакта.

    Рис. 7.

    Нокдаун PEX11 в клетках HeLa.

    (A) Клетки HeLa обрабатывали в течение 96  ч контрольной миРНК (а) или миРНК для PEX11α (b), PEX11β (c) или PEX11γ (d). Затем клетки иммуноокрашивали антителом против Pex14p. Шкала баров: 10 мкм и 5 мкм (вставка). Эффективность нокдауна оценивали с помощью ОТ-ПЦР (д, верхняя панель) и вестерн-блоттинга (д, нижняя панель).Уровни мРНК PEX11α и PEX11γ оценивали с помощью ОТ-ПЦР с использованием тотальной РНК. Актин использовали в качестве контроля загрузки. Уровни белка Pex11pβ подтверждали иммуноблот-анализом с использованием антитела к Pex11pβ. Также оценивали маркерные белки пероксисом, Pex3p и Pex14p. Тубулин использовали в качестве контроля загрузки. Обилие пероксисом на клетку (f), средний размер пероксисом (g) и площадь пероксисом на клетку (h) в каждом типе клеток, обработанных siRNA, определяли, как описано в разделе «Материалы и методы».В каждый момент времени случайным образом отбирали и анализировали не менее 20 клеток. Данные представляют собой среднее ± стандартное отклонение. * р <0,05. (B) Клетки HeLa обрабатывали контрольной siRNA или siRNA для PEX5 в течение 48  ч и иммуноокрашивали антителами к Pex14p (a, c) и каталазе (b, d). Масштабная линейка: 10  мкм. Клетки лизировали и анализировали с помощью SDS-PAGE и иммуноблотинга с использованием антител, указанных справа на панели (e). «p» и «m» на панели ADAPS указывают на более крупный предшественник ADAPS, содержащий PTS2 и его зрелую форму, соответственно.(C) Клетки HeLa трансфицировали в течение 96  ч миРНК, каждая для DLP1 (a) в сочетании с указанными генами (b–e). Затем клетки подвергали иммуноокрашиванию антителом против Pex14p. Шкала баров: 10 мкм и 5 мкм (вставка). Средние длины пероксисом клеток были измерены и нанесены на график (f). Клетки лизировали и анализировали с помощью SDS-PAGE и иммуноблотинга с использованием антител, указанных слева на панели (g). Данные представляют собой среднее ± стандартное отклонение. * р <0,05.

    Рис. 7.

    Нокдаун PEX11 в клетках HeLa.

    (A) Клетки HeLa обрабатывали в течение 96  ч контрольной миРНК (а) или миРНК для PEX11α (b), PEX11β (c) или PEX11γ (d). Затем клетки иммуноокрашивали антителом против Pex14p. Шкала баров: 10 мкм и 5 мкм (вставка). Эффективность нокдауна оценивали с помощью ОТ-ПЦР (д, верхняя панель) и вестерн-блоттинга (д, нижняя панель). Уровни мРНК PEX11α и PEX11γ оценивали с помощью ОТ-ПЦР с использованием тотальной РНК.Актин использовали в качестве контроля загрузки. Уровни белка Pex11pβ подтверждали иммуноблот-анализом с использованием антитела к Pex11pβ. Также оценивали маркерные белки пероксисом, Pex3p и Pex14p. Тубулин использовали в качестве контроля загрузки. Обилие пероксисом на клетку (f), средний размер пероксисом (g) и площадь пероксисом на клетку (h) в каждом типе клеток, обработанных siRNA, определяли, как описано в разделе «Материалы и методы». В каждый момент времени случайным образом отбирали и анализировали не менее 20 клеток. Данные представляют собой среднее ± стандартное отклонение.* р <0,05. (B) Клетки HeLa обрабатывали контрольной siRNA или siRNA для PEX5 в течение 48  ч и иммуноокрашивали антителами к Pex14p (a, c) и каталазе (b, d). Масштабная линейка: 10  мкм. Клетки лизировали и анализировали с помощью SDS-PAGE и иммуноблотинга с использованием антител, указанных справа на панели (e). «p» и «m» на панели ADAPS указывают на более крупный предшественник ADAPS, содержащий PTS2 и его зрелую форму, соответственно. (C) Клетки HeLa трансфицировали в течение 96  ч миРНК, каждая для DLP1 (a) в сочетании с указанными генами (b–e).Затем клетки подвергали иммуноокрашиванию антителом против Pex14p. Шкала баров: 10 мкм и 5 мкм (вставка). Средние длины пероксисом клеток были измерены и нанесены на график (f). Клетки лизировали и анализировали с помощью SDS-PAGE и иммуноблотинга с использованием антител, указанных слева на панели (g). Данные представляют собой среднее ± стандартное отклонение. * р <0,05.

    Дефекты импорта белка пероксисомального матрикса, опосредованного PTS1, влияют на количество пероксисом в фибробластах человека (Chang et al., 1999) и клетки СНО (Otera et al., 2002). Поэтому мы исследовали, препятствует ли нокдаун PEX11 импорту белка пероксисомального матрикса. Белки матрикса PTS1 импортируются в пероксисомы посредством связывания с их цитозольным рецептором Pex5p. В клетках HeLa, обработанных PEX5 siRNA, пероксисомальная локализация каталазы, белка типа PTS1, была нарушена (рис. 7Ba,b), а характер созревания белков матрикса с помощью вестерн-блоттинга показал типичный образец, наблюдаемый в клетках с дефицитом импорта. клетки (рис.7Ве, слева). В таких клетках количество пероксисом было значительно уменьшено без удлинения, как было установлено с Pex14p-позитивными пероксисомами (рис.   7Ba). По сравнению с нокдауном PEX5 , нокдаун PEX11 приводил к нормальному импорту и процессингу белка пероксисомального матрикса, как и в контрольных клетках, обработанных siRNA (рис.   7Be, справа). Эти результаты подтверждают, что Pex11pβ участвует в морфогенезе пероксисом, как это было установлено ранее.

    Влияние Pex11p на морфогенез тестировали в клетках, обработанных DLP1 siRNA, поскольку восстановление с помощью Pex11p приводило к удлинению пероксисом.Когда клетки обрабатывали миРНК для PEX11 в сочетании с DLP1 миРНК, наблюдались более короткие пероксисомы (рис.   7Ca–d,f). Подобно клеткам с одиночным нокдауном, любая из клеток PEX11 – и DLP1 -двойного нокдауна показывает нормальный импорт белка пероксисомального матрикса (рис.   7Cg). В совокупности эти результаты свидетельствуют о том, что удлинение пероксисом было ингибировано в клетках с двойным нокдауном PEX11 и DLP1 .

    Семейство белков Pex11p было идентифицировано как специфичные для пероксисом факторы деления (Abe et al., 1998; Шрадер и др., 1998; Ли и др., 2002а; Ли и Гулд, 2002 г.; Танака и др., 2003). Pex11pβ увеличивает количество пероксисом при сверхэкспрессии в культивируемых клетках, в то время как мыши с нокаутом Pex11pβ имеют меньше пероксисом (Li et al., 2002a). Pex11pβ также участвует в индуцированном docosahexaenoic acid (DHA) делении пероксисом в клетках с дефицитом acyl-CoA oxidase (AOx) (Itoyama et al., 2012). Однако функция Pex11pβ на молекулярном уровне плохо изучена.

    Поэтому мы решили охарактеризовать локализацию Pex11pβ в клетках млекопитающих.Как эндогенный, так и экзогенный Pex11pβ были обогащены в субрегионах пероксисомной мембраны (рис.   1A, B). Pex11pβ отделялся от других белков-маркеров пероксисом в отсутствие DLP1. Удлиненные пероксисомы показали чередующееся окрашивание Pex11pβ и Pex14p/PTS1 (рис. 1B), что согласуется с предыдущими выводами в системе сверхэкспрессии Pex11pβ (Schrader et al., 1998; Li et al., 2002a; Kobayashi et al., 2007). . Сообщалось, что экзогенно экспрессируемый Pex11pβ-Myc индуцирует пероксисомальные канальцы с PMP70-положительными глобулярными концами (Schrader et al., 1998). Точно так же белки семейства Pex11p, меченные EGFP, и белки Pex11pβ, меченные на С-конце YFP, образуют трубчатые пероксисомальные компартменты мембраны из-за ингибирования пероксисомного деления (Kobayashi et al., 2007; Delille et al., 2010; Koch et al., 2010). ). Здесь мы демонстрируем, что сверхэкспрессированный немеченый или Myc-меченый Pex11pβ был включен в мембранные трубочки, обогащенные Pex11pβ, и небольшие везикулы образовались в результате деления этих трубочек (рис.   1A; дополнительный материал, рис. S2B-E). Это отражает тенденцию к делению пероксисом в областях, обогащенных Pex11pβ, указывая на то, что эти точки являются сайтами расщепления DLP1 во время процесса деления.

    Механизм, с помощью которого Pex11pβ опосредует расщепление пероксисом, неизвестен. Возможно, этот процесс происходит за счет деформации мембраны Pex11pβ. DLP1 принадлежит к динаминовому семейству белков, которые обладают активностью самоолигомеризации (Praefcke and McMahon, 2004). DLP1 и другие члены этого семейства белков могут образовывать седиментируемые олигомеры более высокого порядка (Yoon et al., 2001; Tanaka et al., 2006; Chang et al., 2010) и обладают липосомно-тубуляционной активностью (Yoon et al., 2001). Это свойство олигомеризации и тубулирования важно для расщепления мембран с помощью DLP1 in vivo и in vitro (Yoon et al., 2001; Waterham et al., 2007; Chang et al., 2010). При клатрин-опосредованном эндоцитозе цитозольные адапторные белки, несущие липид-связывающие домены [то есть домены N-концевой гомологии эпсин (ENTH), домены Bin-Amphiphysin-Rvs (BAR) и N-концевые домены BAR (N-BAR)], изгибаются. плазматическая мембрана до деления мембраны динамином-1 (Takei et al., 1999; Форд и др., 2002; Ито и др., 2005). Эти адаптерные белки могут полимеризоваться на липидной мембране и индуцировать узкие липидные канальцы in vitro и in vivo (Shupliakov et al., 1997; Wu et al., 2010). Dynamin преимущественно рекрутируется на липидные мембраны с высокой кривизной, указывая на то, что накопленный dynamin-1 обеспечивает эффективную поддержку адапторного белка в месте деления (Takei et al., 2001; Yoshida et al., 2004).

    В нашем исследовании протео-липосомы, восстановленные рекомбинантным His-Pex11pβ, показали изменения в морфологии (рис.   2–4, 6, 7).Сужение мембран наблюдали после восстановления рекомбинантного белка Pex11pβ в липосомы. Подобно нашим результатам, сообщалось о сужении пероксисом в ответ на нокдаун DLP1 (Koch et al., 2004). Ультраструктура пероксисом в клетках HepG2, обработанных DLP1 siRNA, выявила суженное, но взаимосвязанное расположение, подобное бусинкам на нитке. Паттерн сигнала GFP-PTS1 в этих клетках был сегментирован, что согласуется с нашими наблюдениями (рис.1Б). Чередование эндогенных Pex11pβ и PTS1 указывает на то, что Pex11pβ может быть сконцентрирован в суженной области удлиненных пероксисом. EGFP-Pex11pβ и Pex11pβ были локализованы в местах соединения восстановленных липосом, напоминая локализацию эндогенного Pex11pβ (рис. 1, 4, 6). В соответствии с ожидаемой ролью Pex11pβ эти данные предоставляют дополнительные доказательства того, что Pex11pβ образует пероксисомальные сайты деления до действия нижестоящих факторов деления.

    Недавно другая группа продемонстрировала, что синтетический пептид, включающий N-концевую амфипатическую спираль дрожжей Pex11p, заставляет липосомы образовывать трубчатоподобные структуры (Opaliński et al., 2011). Эта активность была необходима для пероксисомального деления H. polymorpha . В наших исследованиях полноразмерного белка Pex11pβ человека функция, очевидно, была установлена ​​и в клетках млекопитающих, что подтверждается введением точечной мутации в эту область, изменившей активность Pex11pβ in vivo и in vitro (рис. 3, 4).Однако мы также интерпретируем эти результаты как означающие, что нарушение активности было обусловлено не только дефектом амфифатических свойств спирали для мембраны, но и нарушением ее способности образовывать олигомеры, поскольку мутантные формы Pex11pβ лишены активность деления показала сниженный уровень образования олигомеров по сравнению с типом with (дополнительный материал, рис. S2F, открытые стрелки). В наших текущих и более ранних исследованиях для его активности требовалось образование олигомера Pex11pβ (дополнительный материал, рис.S2B–E) (Kobayashi et al., 2007; Itoyama et al., 2012). N-концевое цитозольное удлинение Pex11pβ необходимо для образования олигомеров и деления пероксисом. Более того, MBP-Pex11pβ может олигомеризоваться в липосомах, обогащенных DHA, которые напоминают нормальные пероксисомы по липидному составу, но не в липосомах, обогащенных олеиновой кислотой, которые напоминают пероксисомы с дефицитом пролиферации (Itoyama et al., 2012). Соответственно, протолипосомы, восстановленные с помощью His-Pex11pβ, демонстрировали измененную морфологию, когда в качестве исходного материала использовались DHA-PC и DHA-PE (рис. 2–7).Домены BAR и N-BAR содержат амфифатическую спираль (Dawson et al., 2006). Кристаллическая структура показала, что их серповидная структура и распределение положительно заряженных аминокислот на поверхности необходимы для трубчатости мембраны (Peter et al., 2004). Антипараллельные гомодимеры образуют вогнутую поверхность диаметром 22 нм. Эта структура может стабилизировать мембранные канальцы определенных размеров, которые могут регулировать эндоцитарные механизмы пространственно-временным образом. Поскольку аналогичный сценарий может быть правдой для Pex11p млекопитающих, активный олигомер был обнаружен с помощью Blue Native PAGE во всех изомерах Pex11p (дополнительный материал, рис.S2F, открытые стрелки), соответствующий олигомеру, показанному в градиенте глицерина с очищенным белком (Itoyama et al., 2012). Как этот олигомер ориентирован внутри липидной мембраны in vivo и in vitro , неясно, но мутанты Pex11pβ-P и Pex11pβ-φ образуют олигомеры или агрегаты более высокого порядка в Blue Native PAGE (дополнительный материал, рис. S2F, сплошная полоса). стрелки), предполагая, что правильная олигомеризация Pex11pβ способом, зависящим от его N-концевой амфифатической области, важна для трубчатости на липидных мембранах.

    Семейство белков Pex11p содержит три изоформы, а именно Pex11pα, Pex11pβ и Pex11pγ. В наших экспериментах in vivo активность Pex11pβ и Pex11pγ была сходной, а Pex11pα показал меньшую активность. Первые две изоформы индуцировали деление пероксисом при сверхэкспрессии (рис.   3B; дополнительный материал, рис. S2C-F). В то время как Pex11pα проявлял небольшую активность, количество пероксисом было снижено в клетках, в которых PEX11α был нокдаун из-за образования крупных агрегатов пероксисом (рис.7А). Эта агрегация была похожа по структуре на расположенные рядом удлиненные пероксисомы (JEP). JEP образуются из-за дисбаланса белков семейства Pex11p и других факторов деления (Delille et al., 2010; Koch and Brocard, 2012). Pex11pα может балансировать с активностью других активных изоформ, Pex11pβ и Pex11pγ.

    Недавно было высказано предположение, что Pex11pγ может участвовать в импорте белков матрикса в Pex11pβ-дефицитных фибробластах человека (Ebberink et al., 2012). Уровень экспрессии Pex11pγ в клетках пациентов снижался при культивировании клеток при 40°С. В наших анализах не наблюдалось явного дефекта импорта белков матрикса в клетках, в которых PEX11γ был нокдаун. Дополнительный нокдаун PEX5 противодействовал эффекту удлинения пероксисом, индуцированного DLP1 siRNA (рис.   7Cf), и основные белки пероксисомного матрикса не импортировались (рис.   7Cg). С другой стороны, более короткие пероксисомы действительно наблюдались, но меньше в клетках, в которых были нокдауны как DLP1 , так и PEX11γ (рис.7Cd), по сравнению с клетками, в которых был нокдаун только DLP1 (рис.  7Cf). Пероксисомальные PTS1- и PTS2-белки обычно импортировались в клетки с двойным нокдауном (рис.   7Cg). Эти результаты указывают на то, что Pex11pγ играет роль в морфогенезе пероксисом, а не в импорте белков матрикса.

    В заключение, белок Pex11pβ функционирует в пероксисомальном морфогенезе путем деформации пероксисомальной мембраны. Основываясь на этих данных и наших предыдущих наблюдениях, мы предложили модель функции Pex11pβ при пероксисомальном делении, как показано на рис.8. Во-первых, незрелые пероксисомы образуются путем роста и деления зрелых пероксисом и/или образования de novo . Затем такие пероксисомы созревают после импорта белков матрикса и мембраны. Деление пероксисом инициируется ДГК (Itoyama et al., 2012). Включение DHA в предположительно фосфолипиды в пероксисомальной мембране вызывает олигомеризацию Pex11pβ с образованием субобластей, обогащенных Pex11pβ, на мембране и сайтов перетяжки на зрелых пероксисомах.Pex11pβ образует активный олигомер и тесно взаимодействует с мембраной посредством амфифатической спирали, деформируя мембрану в удлиненные трубчатые пероксисомы. Такая деформация мембран впоследствии поддерживает накопление др. факторов деления, включая DLP1 и Mff, в субрегионе, обогащенном Pex11pβ (Itoyama et al., 2013), что приводит к делению пероксисом.

    кДНК

    , кодирующую Pex11pβ человека, амплифицировали с помощью ПЦР с обратной транскрипцией с использованием мРНК из клеток HeLa в качестве матрицы.Продукт ПЦР клонировали в pcDNAZeo3.1 (Life Technologies) для создания немеченой экспрессионной плазмиды Pex11pβ для клеток HeLa. Для конструирования His-меченого Pex11pα фрагмент EcoRI-SalI Pex11pα лигировали в соответствующие сайты pCold1 (Takara, Япония). Для His-Pex11pβ и His-Pex11pγ фрагменты BamHI-EcoRI соответственно амплифицировали и встраивали в pCold1. Слитые с EGFP Pex11pβ и Pex11pγ были созданы путем вставки фрагмента KpnI-BamHI плазмиды, кодирующей MBP, и фрагмента BamHI-BglII плазмиды, кодирующей EGFP, в сайт KpnI-BamHI pCold1-Pex11pβ и pCold1-Pex11pγ соответственно.Для конструирования EGFP-Pex11pα с использованием MBP-EGFP в качестве матрицы фрагмент KpnI-BamHI амплифицировали и лигировали в pCold1, а фрагмент EcoRI-SalI плазмиды, кодирующей Pex11pα, впоследствии вставляли в плазмиду. Введение точечных мутаций в N-концевую амфипатическую спираль Pex11pβ осуществляли путем сайт-направленного мутагенеза с использованием специфических праймеров: Pex11pβ-P sense, 5′-TGAGCCTTGGAAGAAAGCTTCCACGC CTGGGTAACTCAGCACCTGCCCTTGAGTCAGCCAAAAAG-3′; антисмысловой Pex11pβ-P, 5′-CTTTT GGCTGACTCAAGGGCAGGTGCTGAGTTACCCAGGCGTGGAAGCTTTCTTC CAAGGCTCA-3′; смысл Pex11pβ-φ, 5′-ACCTGAGCCTTGGAAGAAAGGAACTACGCGAGGGTAACTCAGAAGATGCCCTTGAGTCAGCCAA-3′; Pex11pβ-φ антисмысловой, 5′-TTGGCTGACTCAAGGGCATCTTCTGAGTTAC CCTCGCGTAGTTTCCTTTCTTCCAAGGCTCAGGT-3′.Pex11pβ-φ содержит мутации L58E, L61E и A65E, а Pex11pβ-P имеет точечные мутации остатков пролина в L59 и D66. Pex14p был получен в виде GST-слияния, как описано ранее (Itoh and Fujiki, 2006).

    Для наблюдения удлинения пероксисом с помощью Pex11pβ в клетках HeLa экспрессировали немеченый Pex11pβ. Клетки фиксировали через 6 часов и 24 часа после трансфекции. Для выявления деления пероксисом, индуцированного Pex11pα, Pex11pβ, Pex11pγ и мутантными формами Pex11pβ, клетки трансфицировали соответствующими плазмидами в течение 24 ч.Чтобы проверить влияние этих факторов деления на Pex11pβ-зависимую пероксисомальную пролиферацию, экспрессирующие Pex11p плазмиды трансфицировали в клетки HeLa, предварительно обработанные в течение 48  часов siRNA для DLP1 или MFF . Клетки фиксировали 4% параформальдегидом в течение 15 мин при комнатной температуре. Пероксисомы визуализировали методом непрямой иммунофлюоресцентной окраски указанными антителами. Первичные антитела выявляли с помощью козьего антимышиного и антикроличьего IgG, конъюгированного с Alexa Fluor 488 или Alexa Fluor 568 (Molecular Probes/Life Technologies).Клетки наблюдали с помощью конфокальной лазерной микроскопии (LSM710; Carl Zeiss, Оберкохен, Германия) с объективом Plan Apochromat 100 ×/1,3 NA. Линейное сканирование выполняли с использованием инструмента Plot profile в программном обеспечении ImageJ (Национальные институты здравоохранения, Бетесда, Мэриленд). Для анализа количества, размера и площади пероксисом получали изображения не менее 30 клеток с помощью конфокальной микроскопии. Каждое изображение было преобразовано в пороговое изображение, а количество пероксисом было измерено с помощью команды Analyze Particle в ImageJ.

    E. coli BL21(DE3) трансформировали с помощью pCold-Pex11p, и экспрессию белка индуцировали при 15°C в течение 24 часов с помощью 0,1 мМ изопропил-β-D-тиогалактозида (IPTG). Клетки собирали и лизировали в саркозиновом буфере 50 мМ Трис-HCl, рН 7,4, 0,5 М NaCl, 2 М мочевины, 50 мМ имидазола, 0,5% N-лауроилсаркозина натрия. После 15-минутной инкубации на льду лизат ультрацентрифугировали при 42000 об/мин в течение 30 мин при 4°C с использованием Hitachi TLA100.3 ротора (Hitachi, Токио, Япония). Супернатант инкубировали с гранулами Ni-NTA (Qiagen, Дюссельдорф, Германия) при 4°C в течение 1 часа, затем гранулы собирали и промывали промывочным буфером 50 мМ Трис-HCl, pH 7,4, 150 мМ NaCl, 0,5% натрия. N-лауроилсаркозин. Белок элюировали промывочным буфером, содержащим 0,3 М имидазол. Буфер для элюирования использовали для восстановления белка в контроле эксперимента. Для очистки белков MBP-EGFP-Pex11p клетки лизировали в буфере, содержащем н -додецил-β-D-мальтозид (Dojindo, Kumamoto, Japan), и белок очищали аффинной амилозной смолой (New England BioLabs, Hertfordshire). , Великобритания) в соответствии с инструкциями производителя.Мы назвали белок MBP-EGFP-Pex11p «EGFP-Pex11p» и использовали его как таковой, поскольку метка MBP не сразу отщеплялась протеазой PreScission (GH Healthcare, Little Chalfont, UK).

    Для электронной микроскопии с отрицательным окрашиванием протео-липосомы адсорбировали на покрытую формваром медную сетку 300 меш (Nissin EM Co., Ltd, Токио, Япония), которая была подвергнута тлеющему разряду непосредственно перед использованием. Сетку отрицательно окрашивали 2% уранилацетатом и исследовали под просвечивающим электронным микроскопом при 200 кВ (Tecnai-20, компания FEI, Эйндховен, Нидерланды).Для определения локализации Pex11pβ протео-липосомы окрашивали антителами к Pex11pβ в течение 1 часа при комнатной температуре (КТ) и метили в течение 1 часа вторичным антителом козы против кроличьего IgG, конъюгированным с частицами золота размером 10 нм (EY Laboratories, Сан-Матео, Калифорния). Затем липосомы собирали ультрацентрифугированием и подвергали электронной микроскопии с отрицательным окрашиванием. Для ультратонких срезов липосомы осаждали и фиксировали 3% глутаральдегидом, а затем обрабатывали для включения в эпон и окрашивания, как описано ранее (Meyerholz et al., 2005).

    Кафедра молекулярной и клеточной биологии

    Американский знак languagearabicbengalichinese (кантонский) Китайский (ган) китайский (хакка) китайский (мандарин) китайский (мин) китайский (WU) китайский (сян) crethouaswevoshubariprispugucrubecrobehaclidrodutchenglishfarsifrenchgawreswivophoswefradelabroclowreswojacavabruspipheclodanenatrastogermangreekgujaratihebrewhindiitalianjapanesekannadakoreanmalayalammarathinespepofrasobabikospodrawisposuhootherportuguesepunjabirolithararochucrudruslicremaswejahicuswuspojawristimarispegathatreswostonetauucowrechakiswuphehuwragespiparussiansomalispanishtagalogtamiltelugutruclotiruchucrephirethespahomowinuuupophaspepoclilocruvuspasowefristapreroprophothelevithturkishurduvietnamese

    брюшная аорта aneurysmabdominal painabdominal swellingabnormal анализ крови причина по kidneyabnormal менструального bleedingabnormal мазок smearsachilles tendonitisacid база / электролит disturbancesacl injuryacneacoustic neuromaacquired кручение dystoniaactinic keratosisacute и хронический угол закрытие почечной failureacute glaucomaacute careacute ишемической strokeacute почка diseaseaddison это diseaseadjustment disorderadult врожденного сердце diseasealtered умственную statusalveolar hypoventilationalzheimer это diseaseamenorrheaampullary canceramyloidosisanal canceranal fissureanal fistulaanemia расстройства травмы лодыжкирастяжение связок лодыжкиотек лодыжкианкилозирующий спондилоартританоректальный абсцессанорексиятревогааортальная регургитацияаортальная хирургиястеноз аортального клапанаапоневротический птозаппендикулярный раканевризмыартериовенозная мальформацияаневризмы восходящей аортысиндром Маспергераастмаастигматаксияатеросклероз гиперактивностьатриальный дерматит скует parkinsonismautismautoimmune diseaseautoimmune encephalitisavascular necrosisback painback traumabarrett esophagusbasal клетки carcinomabenign neoplasmbenign простатического hyperplasiabicipital tendinitisbig spleenbile проток cancerbiliary пациент заболевания, требующий ercpbiliary пациента заболевания, требующего eusbipolar disorderbladder cancerbladder infectionbladder камень, urinaryblood в urinebloodclotting problemsbody дисморфоз disorderbone cancerbone infectionborderline личность disorderbrachial сплетение injurybradycardiabrain abscessbrain артериовенозной malformationbrain bleedbrain tumorbreast abscessbreast cancerbreast cystbreast жировой некрозфиброаденома молочной железысломанные костисломанная челюстьсломанная ногабронхоэктазыбронхитбурсит большого пальца стопысиндром горящего ртаожогибурситраксердечная аритмиякардиомегалиякардиомиопатияпрофилактика сердечно-сосудистых заболеванийболезнь сонных артерийсиндром запястного каналакатарактазаболевания кавернозного синуса целиакияцентральная нервная система васкулитцентральное апноэ сна rebellar ataxiacerebellar hemorrhagecerebellar syndromecerebral aneurysmcerebral contusioncerebral palsycerebral сосудистой accidentcerebrospinal жидкость rhinorrheacerebrovascular accidentcervical myelopathycervical polypscervical radiculopathycervical позвоночник stenosiscervical spondylosiscfrdcharcot-Мари-Тут diseasecheck-upchiari malformationscholecystitischoledocholithiasischolelithiasischolesteatomacholesterolchondromalaciachronic назад painchronic состояния от childhoodchronic diarrheachronic заболевания managementchronic почек diseasechronic печени diseasechronic mastoiditischronic миелолейкоз leukemiachronic обструктивного легочного diseasechronic painchronic sinusitischronic миндалина и adenoidscircadian ритма расстройствациррозперелом ключицыclostridium difficileкоарктация аортоколитарак толстой кишкирасстройство толстой кишкиполипы толстой кишкидивертикулит толстой кишкипростудасложные парциальные припадкикомплексный регионарный болевой синдромкомпрессионный переломсотрясение мозганарушение поведения врожденный порок сердцаконг Estive сердце failureconstipationcontact dermatitisconversion перепускной disordercoronary шунтирование (АКШ) коронарной артерии diseasecoronary артерии dissectioncorticobasal degenerationcubital туннель syndromecushing diseasecystic fibrosiscystic диабет фиброз связанных, cfrdcystoceledandruffde Кервена tenosynovitisdeconditioningdeep венозная thrombosisdelusional disorderdementiademyelinating diseasesdescending и торакоабдоминальной аортальный aneurysmdetached retinadevelopmental delaydiabetes insipidusdiabetes диабет типа 1diabetes диабет типа 2diabetic footdiabetic ketoacidosisdiabetic nephropathydiabetic retinopathydifficulty глотаниеболезнь гортаниболезнь глоткиболезнь вульвывывих хрусталикарасслаивающая аневризма аортыдивертикулитсиндром Дауназлоупотребление наркотикамипротоковая карцинома in situдуоденальный ракконтракт Дюпюитренауруральный артериальный венозный фистулы головного и спинного мозгадисфункция евстахиевой трубыдислексиядислипидемиядисфониядисфимиядистониявывих локтя ncephalopathyendocarditisendometrial polypsendometriosisendophthalmitisendovascular ремонт аорты aneurysmsenlarged лимфатического nodeseosinophilic esophagitiseosinophilic желудочно-кишечного diseaseepidural abscessepidural hematomaepilepsyesophageal achalasiaesophageal canceresophageal disorderesophageal моторики disorderesophageal strictureesophageal varicesesophagitisessential hypertensionessential tremorextremity traumaface & шеи injuryface и шеи injuryfacial кости fracturefacial нерва paralysisfacial traumafallen archesfallsfamily medicinefamily physicianfarsightednessfecal impactionfecal incontinencefemale incontinencefemur fracturefibrocystic breastsfibromyalgiafinger dislocationfinger fracturefinger lacerationfistulasflat feetfluid в средней earfoot переломрастяжение связок стопыотек стопыязва стопыперелом предплечьяперелом ломкой Х-синдроматаксия Фридрейханарушение походкирак желчного пузыряполипы желчного пузыряжелчнокаменная болезньшунтирование желудка в анамнезерак желудкаязва желудкагастритгастрит гастроэзофагеальный рефлюкс желудочно-кишечное кровотечение желудочно-кишечный рак перфорация желудочно-кишечного тракта стромальная опухольгастропарезобщая внутренняя медицинагенерализованное судорожное расстройствогенетические и кистозные заболевания почекгенетические и кистозные заболевания почекгенетическое состояниегенетическая мутациягенитальный герпесгенитальные бородавкирак мочеполовой системыгериатрическая гастроэнтерологиягериатрические синдромыглаукомагломерулонефритзоб локоть гольфистаподагра болезнь глазболезнь Грейвсабольшой вертельный бурсит гуморальный бурситпилори infectionhammer toeshamstring injuryhand fracturehand lacerationhead и шеи cancerheadachehearing disordersheart ремонт и замену клапана, в том числе tavrhemangiomahematocelehemorrhagehemorrhagic strokehemorrhoidhemorrhoidshepatitishepatitis ahepatitis bhepatitis cherniaherniated dischiatial herniahigh cholesterolhigh клетки белой крови counthip arthritiship painhiv aidshodgkin это diseasehuntington diseasehydrocelehydrocephalushydronephrosishyperlipidemiahyperosmolar гипергликемии statehyperparathyroidismhypersomniahypertensionhyperthyroidismhypertrophic cardiomyopathyhypoglycemiahypoparathyroidismhypothyroidismhypoventilation в нервно-мышечной diseaseidiopathic тромбоцитопения purpuraileitisimmunizationsimpingement синдром shoulderincisional herniainfectioninflammation из тестикул tubesinflammatory кишечника diseaseinflammatory заболевание кишечника, межпозвонковая грыжа, бессонница, умственная отсталость, интерстициальный цистит, интерстициальное заболевание легких, внутричерепное кровоизлияние, инвагинация, подозрение инвазивной протоковой carcinomainvasive очаговая carcinomairritable кишечника syndromeirritable кишечника синдром, ibsjoint arthritisjoint infectionjoint painkeloidkidney stonekidney transplantationknee injuryknee связки sprainknee painleg swellingleukemialewy тела dementialichen planusligament sprainligament tearliver cancerlou Герига diseaselow назад painlow крови pressurelow белых кровяных клеток countlower ноги fracturelumbar radiculopathylumbar спинного stenosislumbar spondylosislung & грудь infectionslung и грудь infectionslung cancerlupuslyme болезньлимфедемакулезная дегенерациябольшое депрессивное расстройствосиндром мальабсорбциимужское бесплодиезлокачественная мезотелиомамолоткообразный палецсиндром марфанамаститмастоидитрак верхнечелюстной пазухидивертикул меккелямедиастинитмедицинские расстройства и проблемы во время беременностимедицинский комплексмедицински хрупкаямеланомамеламеньера болезньменингиомамениск травмыменопаузаменструальные расстройствааномалия среднего ухамигреньмитральная регургитациямитральная регургитация ве prolapsemolar pregnancymolemouth cancermoyamoyamugsmultiple myelomamultiple pregnancymultiple sclerosismultiple Система atrophymuscle painmuscle strainmuscle tearmuscle слабость-generalmyasthenia gravismyelodysplasiamyocardial infarctionmyocarditismyositisnarcolepsynasal cancernasal deformitynasal fracturenasal polypsnasal перегородку deviationnasopharyngeal carcinomanausea / vomitingnearsightednessneck painnervous stomachneuroendocrine cancerneuromyelitis Optica спектр disordersnon сердца в грудной клетке painnon-Ходжкина lymphomanonsteroidal противовоспалительный препарат overdosenose elbowobesityobesity гиповентиляции syndromeobsessive компульсивное disorderoccupational легкого bleednursemaid в болезнь неврит зрительного нерва лейкоплакия полости ртаперелом орбитыорбитальный массорхитостеоартритостеохондрит диссекансоостеопенияостеопороз киста яичникагиперактивный мочевой пузырьтравмы чрезмерного использованияПеджет болезнь костиПеджет болезнь соскаболь поджелудочная железа билиарная воспаление поджелудочной железырак поджелудочной железынейроэндокринная опухоль поджелудочной железы morspancreatic pseudocystpancreatitic cystpancreatitispanhypopituitarismpanic disorderparasomniasparasophageal herniaparathyroid cancerparkinson-х diseaseparotitispatellar dislocationpatellar сухожилия rupturepelvic органа prolapsepelvic painpemphigoidperipheral нерва transectionperipheral сосудистой diseaseperitoneal mesotheliomaperitonsillar abscesspersonality disorderpharyngeal pouchpheochromocytomaphimosisphobiaspituitary tumorplantar fasciitisplasmacell disorderspleural effusionpneumothoraxpolycystic diseasepolymyalgia почек rheumaticapolypharmacypost оперативное painpost-травматического стресса disorderposterior крестообразной связки injuriesposterior стекловидное detachmentprediabetespregnancypregnancy complicationspresbyopiapreventionpriapismprimary careprimary склерозирующий cholangitisprogressive надъядерного palsyprostate cancerprotein в urinepseudogoutpseudotumor cerebripsoriasispsoriatic arthritispuerperal депрессия, фиброз легких, колотая рана, колотая рана пальца, рука, психогенное движение d isorderradial голова fracturerashraynaud это diseaserectal bleedingrectal cancerreflex симпатическая недостаточность dystrophyrenal, acuterenal недостаточность, chronicrespiratory failureretinal артерии occlusionretinal вены occlusionrheumatoid arthritisrheumatologic и клубочковой diseasesrosacearotator манжета syndromerunning injuriessarcomascaphoid fracturescarschizoaffective disorderschizophreniasciaticasclerodermascoliosisseasonal аффективное disorderseborrheic dermatitisseizuresemicircular канал fistulasexual здоровья и dysfunctionsexually передается diseaseshin splintsshockshoulder и локоть injuriesshoulder injuryshoulder совместного dislocationshoulder painshoulder sprainsi совместной dysfunctionsickle клетки заболеваниясинуситситуативные депрессиисиндромы Джогренасонное апноэнарушения движений во снерак тонкой кишкилимфома тонкой кишкимелкоклеточный рак легкихопухоли тонкой кишкикурениехрапсоциальные тревожные расстройствасоматическое расстройствоособые потребностисперматоцелеспина бифидатравма спинного мозга, острый спинной мозг д tumorsplenic tumorsspondylolisthesissports injurysprainsquamous клеток cancerstenosis из larynxstidricatetumucloproswitathurutralewrodacidechoclidraprodrunuuesegibuwrenispechuwisladiwithudritruwefrikurenovubrowithechihawadrichophuchichocrofroshanisposwustawedethastaravushedopruphephadrowripiwrotrocovusaswephichebawropicleshubeuuvucratodrustomach cancerstructural сердца diseasesubarachnoid hemorrhagesubstance abusesupracondylar fracturesurgical ремонт другой аорты и сердца лечения anomaliessurgical (симпатэктомия) для hyperhidrosisswallowing disorderssystemic sclerosistachycardiatemporal arteritistemporal лопасть epilepsytendon lacerationtendonitistennis elbowtenosynovitistesticular cancertesticular torsiontestosterone deficiencythafrocutejophuuuthoribiboslaspawogugafrenobropracudricomuwrespobrospuswibretharavemudrawrusholosevupiluwihistoclawrosuviphuchebraclokocislitoclthalassemiathoracic spondylosisthymoma / тимуса carcinomathyroid cancerthyroid cystthyroiditistoe fracturetongue может certonsillar cancertourette syndrometransient глобальной amnesiatransient ишемической attacktransverse myelitistraumatraumatic мозг injurytraumatic нерв injurytravel medicinetriangular хрящевого комплекс injurytrigeminal neuralgiatrigger fingertriple отрицательного груди cancertropical infectionstumors рот, головы и necktylenol overdosetylenol poisoningulcerative colitisulcerative proctitisulnar neuropathyumbilical herniaunexplained затрудненного breathupper дыхательных пути infectionurethral diverticulumurethral strictureurethritisurinary incontinenceurinary obstructionurinary камень diseaseurinary тракт malformationurine ретенционная миома маткивыпадение матки вагинальный атрофивагинит операция на клапане клапанная болезнь сердцасосудистая деменцияваскулитвасэктомияреверсия вазэктомиивентральная грыжавертигоголовная болезнь паралич голосовых связокмакроглобулинемия Вальденстремагранулематоз Вегенера потеря весаперелом запястьярастяжение запястьядивертикул Ценкера

    брюшной стенки reconstructionaddiction развития geneticsadult рак medicineadult careadult geneticsaesthetic surgeryallergy и immunologyanatomic и клинические pathologyaortic surgeryarthroscopic surgeryaudiologybalance disordersballoon endoscopybariatric surgerybehavioral medicineblood и carebody рак contouringbotulinum токсин injectionsbrachial сплетение грудиПластика oncologybreast reconstructionbreast surgerycancer carecancer survivorshipcardiac surgerycardiologycardiothoracic surgerycardiovascular surgerycarpal туннель releaseceliac blockcerebrovascular surgeryclinical биохимический geneticsclinical сердца electrophysiologyclinical cytogeneticsclinical geneticsclinical lipidologyclinical молекулярной geneticsclinical нейрофизиологияклиническая патологияклиническая психологияхирургия толстой и прямой кишкикомплексная реконструкция ожоговмедицина консьержакосметическая хирургиямедицина интенсивной терапиихирургия интенсивной терапиимуковисцидозхирургия глубокой стимуляции мозга (DBS)программирование глубокой стимуляции мозгаde дерматологиядерматопатологиядиабет, эндокринология и обмен веществрадиологическая диагностикадиализ ушей, носа и горлаэхокардиографияхирургия локтяэлектромиография и исследования нервной проводимостинеотложная общая хирургияэндокринная хирургияэндокринологиягенетика эпилепсииэзофагеальная хирургиялицо, шея и бровьпластика лицареконструкция лицасемейная медицинакормящая трубкавмешательство плода хирургия плодахирургия стопы и голеностопного суставахирургия стопы и голеностопного суставаонкогинекология головы и шеиобщая медицинагерия общая неврология хирургияпсихология здоровьяпересадка сердца и легкиххирургия клапанов сердцагематологиягепатологияхирургия грыжтравмы бедра и коленахирургия тазобедренного суставагипертермическая интраперсионная химиотерапия (hipec)инфекционная медицинабесплодие и репродуктивная эндокринологиявнутренняя медицинаинтервенционная кардиологияинтервенционная пульмонологияинъекции суставоввосстановление и восстановление суставовзамена суставовкейокропфьер isleshuwkidney transplantationknee surgerylimb salvageliver surgerylower оконечность surgerylung surgerylymphedema surgerymaternal и плода medicinemedical биохимический geneticsmesotheliomamicrosurgeryminimally инвазивной гинекологической surgeryminimally инвазивной surgerymivisiwrupitotroprejachaslagefresliwrebridaguclustuthuteslophenacutmohs surgerymusculoskeletal medicinenephrologyneuro oncologyneurodevelopment disabilitiesneurogeneticsneurologyneuromuscular medicineneuropsychologyneurosurgeryobstetrics и gynecologyoncologyophthalmologyoptometryoral и челюстно surgeryorthopedic рука surgeryorthopedic surgeryorthopedic травма surgeryosteoarthritisotolaryngologyotology и neurotologyoveruse injuriespain managementpain medicinepancreas болезнь surgeryparkinson-х и движение disorderspebrastaswastaratuphothuricebutibovuprecrecribrajijapruclathipepediatric подростков gynecologypediatric endocrinologypediatric surgeryphysical медицины и для реабилитациифизиотерапияпластическая хирургияиз пластика IC хирургии в голове и neckpodiatrypodiatrypreventive medicinepsychiatrypsychologypulmonologyradiation oncologyradiological physicsradiologyreflux surgeryregenerative medicineregenerative медицина therapyregenerative спорта medicinereproductive psychiatryrheumatologyribiwapuvuhopagajipusaswovapheshivasuprojimepaspaueuespechobicherobotic surgeryrunning injuriesshoulder и локоть injuriesshoulder surgeryshoulder surgerysi сустава dysfunctionskin cancerskull surgerysleep medicinespine managementspine medicinespine neurosurgeryspine surgerysports medicinesports медицина rehabilitationsports медицина surgerysports специфический rehabilitationsurgical критический caresurgical oncologysurgical specialtiesthoracic surgerythyroid surgerytosepislimiswuswustesupudalohiuecrigoprephowrasteguwushebimehebresidrikiwriuewrojupephetriwoshukedribrawrebrabrofrolaslihuswitririfrogtotal сустава replacementtransplant hepatologytransplant surgerytrauma хирургия, инъекция опорно-двигательного аппарата под ультразвуковым контролем, урогинекологический гинекологиясосудистая неврологиясосудистая хирургияреверсия вазэктомиипроцедура/операция по снижению весапроцедура уипплалечение ранхирургия запястья

    Поиск

    .